Bio lab exam 1

Which substances exited the dialysis bag? Why were those substances able to exit the bag?

Only glucose was able to exit the dialysis bag because it is small enough to pass through the semipermeable membrane of the dialysis bag (it is smaller than 10,000 daltons).

Would you have detected glucose in the external solution if you had used a biological membrane instead of a dialysis tubing? Why?

Glucose can't usually diffuse across the membrane on its own, but if there are transport proteins for glucose present then the glucose may be detected in the external solution.

How does a biological membrane differ from the dialysis tubing? What is a similarity between the two?

The dialysis tubing only cares about size of the substance, whereas a biological membrane considers other factors, including size and polarity. Also, a biological membrane is composed of phospholipids, while the dialysis tubing is composed of cellulose. They are similar because the net diffusion for both is from a higher concentration gradient to a lower concentration gradient. Also, they are both semipermeable.

Why was the tube containing the water included in the Benedict's test?

The tube containing the water was a negative control. It didn't have glucose in it so we were able to compare it with the tubes that did have glucose in them.

Consider that a second protein was added to Solution A. Would that protein leave the dialysis bag? Why or why not?

It depends on the size of the protein. If the protein is smaller than 10,000 daltons, it should be able to leave the dialysis bag.

Which solution led to the most dramatic observed change in an animal cell? Which solution led to the most dramatic observed change in a plant cell? Describe what you observed.

The hypotonic solution led to the most dramatic change in the animal cells. The cells lysed when they absorbed too much water. The hypertonic solution led to the most dramatic change in the plant cells. The cells plasmolyzed even though the cell wall kept its structure.

You were given a bag (made of the same dialysis tubing used in this experiment) with solution "x" (unknown to you) and asked to place it into a beaker filled with a solution "y" (also unknown to you). If the bag does not change shape over the course of the experiment, you can conclude that...

The solution is isotonic (solution "x" and "y" have the same concentration of solute) because there is no net movement of solute between the inside and the outside of the bag.

How are nuclei isolated from the rest of the homogenate?

The nuclei are isolated from the rest of the homogenate by microcentrifugation. Since the nuclei are denser than the homogenate, they settle at the bottom of the centrifugation tube. We were able to decant the homogenate so that the pellet of the nuclei remained.

You get to the end of the experiment and do not have any DNA. List three possible reasons.

- The cell membrane or the nuclear membrane were not broken open properly by the detergent.

- DNase was not completely inhibited so it hydrolyzed the DNA.

- No ethanol was added to the final solution so DNA wasn't able to precipitate.

Would you expect the structure of the DNA isolated from the wheat germ to differ from the structure of DNA isolated from the cheek cells? If so, how?

No, they should both have the same double helix shape and they should consist of the same four nitrogenous bases (A, T, G, C). The only difference in the DNA structures would be the sequence of bases.

Describe the appearance of isolated DNA.

The isolated DNA looked like a cloudy white, coiled string.

The restriction enzyme Hpa I recognizes the sequence

5'...GTT//AAC...3'

3'...CAA//TTG...5'

How many times will Hpa I cut the following sequence?

5'...GATACGTCTGACGTCGTTAACACTCTGCATTGCTGACGTTAACTGACGTCAGGGATAG...3'

3'...CTATGCAGACTGCAGCAATTGTGAGACGTAACGACTGCAATTGACTGCAGTCCCTATC...5'

Hpa I will cut the fragment two times.

5'...GATACGTCTGACGTCGTT--//--AACACTCTGCATTGCTGACGTT--//--AACTGACGTCAGGGATAG...3'

3'...CTATGCAGACTGCAGCAA--//--TTGTGAGACGTAACGACTGCAA--//--TTGACTGCAGTCCCTATC...5'

Draw the fragments that result from Hpa I's digestion of the above sequence.

Hpa I will digest the sequence into three fragments.

5'...GATACGTCTGACGTCGTT...3'

3'...CTATGCAGACTGCAGCAA...5'

5'...AACACTCTGCATTGCTGACGTT...3'

3'...TTGTGAGACGTAACGACTGCAA...5'

5'...AACTGACGTCAGGGATAG...3'

3'...TTGACTGCAGTCCCTATC...5'

What is different about the DNA fragments created by digestion with Hpa I as compared to the DNA fragments created by digestion with EcoRi?

The DNA fragments created by digestion with EcoRI have sticky ends, while the DNA fragments created by digestion with Hpa I have blunt ends.

Would the EcoRI enzyme digest the DNA fragment? Why or why not?

The EcoRI enzyme would not digest the DNA fragment because there is no GAATTC/CTTAAG sequence in the fragment to signal the EcoRI.

The restriction Xba I recognizes the sequence

5'...T//CTAGA...3'

3'...AGATC//T...5'

How many times will Xba I cut the following sequence (plasmid)?

TCCTGATCTAGAATCTAGAATGA

AGGACTAGATCTTAGATCTTACT

Xba I will cut the sequence two times.

TCCTGAT//CTAGAAT//CTAGAATGA

AGGACTAGATC//TTAGATC//TTACT

How many fragments will result from the Xba I's digestion of the sequence?

Xba I will cut the plasmid into two fragments.

Draw the fragments that result from Xba I's digestion of the plasmid.

5'...CTAGAATGATCCTGAT...3'

3'...TTACTAGGACTAGATC...5'

5'...CTAGAAT...3'

3'...TTAGATC...5'

Which of the DNA samples have the same number of restriction sites for the restriction endonucleases used? Write the lane numbers.

Lanes 2, 5, and 6 + lanes 3 and 4 have the same number of restriction sites for the restriction endonuclease used.

Which sample has the smallest DNA fragment? Which sample has the largest? Do you need to run a KB ladder to know which sample has the smallest DNA fragment? Why or why not?

S4 has the smallest DNA fragment. S2 has the largest DNA fragment. We don't need to run a KB ladder to know which sample has the smallest DNA fragment because we expect the smallest DNA fragment to travel the farthest from the wells.

Assuming a circular piece of DNA (plasmid) was used as starting material, how many restriction sites were there in the DNA sample in lane 6? Now assume the plasmid used as starting material was linearized. How many restriction sites were there in the DNA sample in lane 6?

If the DNA used was circular, there were three restriction sites. If the DNA used was linear, there were two restriction sites.

Based on your analysis of the gel, what is your conclusion about the DNA samples in the picture? Do any of the samples seem to be from the same source? If so, which ones? Describe the evidence that supports your conclusion.

S2 appears to match the CS sample. The bands of S2 line up with the bands of the CS sample.

Based on the standard curve, the smallest band visible is the crime scene sample lane is ___ KB. The next smallest band visible in the crime scene sample lane is ___ KB.

Based on the standard curve, the smallest band visible is the crime scene sample lane is 0.5 KB. The next smallest band visible in the crime scene sample lane is 0.16 KB.