Gene Transcription & Regulation

Most genes encode for

proteins

Transcription factors

1. TBP (TATA-binding protein) bind to TATA box, recruiting TFIID

2. TFIIB & TFIIA stabilize and enhance TBP binding

3. TFIIF recruits and positions RNA poly II

4. TFIIE & TFIIH help transition from initiation to elongation

5. TFIIH phosphorylates C-terminal domain (CTD) of RNA poly II

6. Once RNA poly II is phosphorylated, escapes promotor and starts sythesis

To create a protein a gene must generate a

mRNA molecule (transcription)

mRNA

Messenger RNA (mRNA) carries copy of genetic information from DNA to the ribosome for protein synthesis…”mRNA transcript”

transcription

gene's DNA sequence is copied to produce an mRNA molecule, occurs in nucleus

what molecule is an intermediate between transcription & translation

mRNA

RNA Polymerase

Enzyme that synthesizes RNA from a DNA template

RNA polymerase synthesizes RNA in what direction

5’ to 3’

RNA polymerase uses what as a template

DNA

where does mRNA go

cytoplasm to undergo translation

DNA polymerase

synthesize DNA using DNA template, uses A, T, G, C, 5’ to 3’, requires primer

why does DNA polymerase require a primer?

because it can only extend an existing strand of nucleic acid, not initiate synthesis. The primer provides a starting point with a 3' hydroxyl (-OH) group necessary for adding nucleotides

why does RNA polymerase not require a primer?

can initiate synthesis de novo (without a primer) It has the ability to form a phosphodiester bond without needing an existing nucleic acid strand.

de novo initiation/synthesis

RNA polymerase doesn’t require a pre-existing primer molecule…starts building the RNA chain from scratch at the transcription start site…can begin RNA synthesis directly on the DNA template

RNA polymerase

synthesis RNA using DNA template, uses A, U, G, C, 5’ to 3’, doesn’t require primer

what direction does RNA polymerase read DNA template?

3’ to 5’

Every gene has one specific

template…figure out which one based on where the promotor is

What’s the RNA polymerase involved in gene transcription?

RNA pol II

Sigma factor

recruits RNA polymerase to promotors

How does RNA pol II know where to start?

promotor

All genes have what sequence at the beginning?

promotor sequence

What acts as a switch on the gene?

promotor…RNA recognizes and starts transcription

is promotor DNA or RNA

DNA

what 2 main elements/sequences does the promotor have in prokaryotes

-10 TATAAT Pribnow box, and -35 TTGACA

-10 TATAAT Pribnow box

DNA sequence found in prokaryotic promoters that serves as a binding site for RNA polymerase, allowing it to recognize and attach to DNA…facilitates unwinding of DNA, enabling polymerase to initiate mRNA synthesis…located 10 base pairs before transcription start site

-35 TTGACA

DNA sequence found in prokaryotic promoters that serves as a binding site for RNA polymerase, allowing it to recognize and attach to DNA…facilitates unwinding of DNA, enabling polymerase to initiate mRNA synthesis…located 35 base pairs before transcription start site

How does RNA pol II start transcription

sigma factor recognizes the Pribnow box and brings RNA pol II to promoter, DNA unwound, RNA pol II begins to synthesize mRNA transcript, once started—sigma factor released from holoenzyme

1st nucleotide transcribed

position +1

holoenzyme

large complex of RNA polymerase and other proteins (polypeptides) that initiates transcription…made up of 4 peptide chains: a, b, b’, sigma

catalytic RNA pol II subunits

b & b’ …they add nucleotides & create RNA using DNA template

what unwinds the DNA in transcription

holoenzyme (RNA pol II)

how does RNA pol II know where to stop transcription?

terminator sequences

the sigma factor has an affinity for what?

RNA pol II and promotor sequence

what sequence starts transcription

promoter

what sequence ends transcription

terminator

how do terminators stop transcription

GC-rich inverted repeat followed by a string of U's (e.g., AUUAAAGGCUCCUUUUGGAGCCUUUUUU)…forms a hairpin (stem-loop) structure in the mRNA that disrupts mRNA and RNA pol II binding with DNA template

3 steps that transcription follows

1. Initiation: promoter brings RNA pol II to DNA, starts unwind

2. Elongation: RNA poll elongates/synthesizes

3. Termination: sequences form hairpins

How many forms of RNA polymerase in eukaryotes

RNA pol I, II, and III

RNA pol I

produces rRNA, not coding for proteins

RNA pol II

transcribes all protein-coding genes, makes mRNA

RNA pol III

transcribes all tRNA genes and some rRNA, does not code for proteins

Do all genes code for proteins

NO…some code for rRNA and tRNA

True or False: All genes make mRNA

False

Transcription differences eukaryotic and prokaryotic

1. nucleosomes

2. multiple transcription factors

3. structure of promoter

4. regulatory sequences beyond promoter regions

transcription in eukaryotes: nucleosomes

DNA packed as nucleosomes into chromatin… needs a mechanism to access DNA…nucleosome remodeling complexes and histone modification complexes relax chromatin and make it accessible for transcription

which complexes relax chromatin & allow transcription

nucleosome remodeling complexes and histone modification complexes

transcription in eukaryotes: multiple transcription factors

more than just RNA pol II…many transcription factors, especially for initiation of transcription…recruit RNA pol II, activate transcription, repress transcription

general transcription factors

act in almost all genes, Ex. TFIIA & TFIIB: bind promoters & recruit RNA pol II

specific transcription factors

only act in specific set of genes only 1 or few genes, Ex. CREB: binds sequences found in only certain genes, long-term memory formation in brain

transcription in eukaryotes: other regulatory sequences beyond promoter regions

DNA regions called enhancers: promote transcription or silencers: inhibit transcription…can be very far from gene promoter…recognized by activators or inhibitors factors…influence transcription even from far b/c induce loops that place them in contact with holoenzyme

activators

transcription factor, protein that bind genes at enhancers, speed up rate of transcription

inhibitors/repressors

transcription factor, protein that binds to selected sets of genes at silencers, slows transcription

how is pre-mRNA processed into mRNA

5’ cap, poly A tail, splicing

5’ capping

7-methylguanosine (modified guanosine [nucleotide] methylated at position 7’) added to 5’ end of pre-mRNA (beginning of RNA!), 5’ to 5’ tri-phosphodiester bond instead of 3’ to 5’ phosphodiester bond (odd!), pre-mRNA 5’ capped before transcription finishes, protect nascent (freshly made) RNA transcript from degradation by 5’ exonucleases present in cells

7-methylguanosine (m7G)

guanosine (nucleotide) with a methyl (-CH3) group added at the 7th position of its nitrogenous base.

methylated

addition of a methyl (-CH3) group

5’ exonucleases

enzymes that chew up RNA from 5’ end

5’ capping is like

an helmet put on the beginning of RNA

poly A tail

string of adenosine (polyA) is added to 3’ end…process begins when series of cleavage factors recognize sequence (most common: AAUAAA) around 3’ end of pre-mRNA…cleavage factors recruit PolyA polymerase that cleaves 3’ end and starts to add multiple A’s to create a tail…once tail created polyA binding protein (PAB) recognizes and binds polyA tail to stabilize

cleavage factors

proteins that recognize a specific sequence near the 3' end of the pre-mRNA, help cut the RNA toward the 3' end (removes extra RNA that is not needed), recruits PAP and PAB

Polyadenylation Signal (AAUAAA)

most common sequence recognized is AAUAAA…tells the cell where to cut and add the poly(A) tail

what enzyme enzyme called attaches to the RNA and adds adenine (A) nucleotides to the 3' end

PolyA Polymerase (PAP)

PolyA Polymerase (PAP)

enzyme that attaches to the RNA, cleaves 3’ end and starts to add multiple A’s to create a tail

what proteins recogize polyadenylation signal

cleavage factors

polyA binding protein (PAB)

binds to the poly(A) tail…stabilizes mRNA, protects mRNA from degradation, prevents exonucleases (enzymes that degrade RNA) from chewing up the mRNA.

intron

Non-coding regions that do not contribute to the final protein, Removed during splicing in RNA processing…allow for alternative splicing, creating different proteins from one gene…starts with ‘GU’ sequence (5’ site) and ends with ‘AG’ sequence (3’ site)…has a ‘branch point’ that forms a lariat

branch point

spliceosome recognizes and uses it to form a lariat (loop-like structure) that helps remove the intron.

exon

Coding regions that contain instructions for making proteins…Kept in the final mRNA after splicing…Joined together in different combinations during alternative splicing, leading to multiple proteins from a single gene…starts with

splicing

introns (non-coding regions) are removed from the pre-mRNA, and exons (coding regions) are joined together to form a mature mRNA, performed by spliceosome proteins…spliceosomes recognize ‘GU’ (5’ site), branch point to form lariat, and ‘AG’ (3’ site) terminal sequence where it cleaves and ligates (joins) the two exons—resolving the lariat

spliceosome

proteins that remove introns from pre-mRNA and joins exons together to form mature mRNA…”molecular scissors”

why is mRNA much shorter than original DNA or pre-mRNA

SPLICING…introns are cleaved out, producing exon-only mRNA

alternative splicing

ability to create different types of mRNA transcripts from a single gene by changing how the pre-mRNA is spliced…production of multiple proteins from the same gene…increases the diversity of proteins in eukaryotic cells without needing additional genes.

do prokaryotes do splicing

no

evolutionary advantage to have exons and introns

alternative splicing..can make many new proteins without increasing the number of genes

do we have more genes or proteins in cells

proteins because of alternative splicing

what types of reactions occur in splicing

2 transesterification reactions driven by 2 nucleophilic attacks

1st transesterification reaction in splicing

Adenine makes nucleophilic attack to phosphate that unites last exon nucleotide to 1st intron nucleotide

can genes have more than 1 start and stop codon

yes…not mRNA

does splicing occur during transcription

yes

can mRNA have more than 1 start and stop codon

no