Final Study Guide

Which macromolecule is made up of amino acids?

A. Lipids; B. Carbohydrates; C. Protein; D. Nucleic Acids

C. Protein

Which macromolecule is made up of sugars, starches, and fiber?

A. Lipids; B. Carbohydrates; C. Protein; D. Nucleic Acids

B. Carbohydrates

Which macromolecule is made up of fats and oils?

A. Lipids; B. Carbohydrates; C. Protein; D. Nucleic Acids

A. Lipids

Which macromolecule is made up of nucleotides?

A. Lipids; B. Carbohydrates; C. Protein; D. Nucleic Acids

D. Nucleic acid

Which macromolecule makes up a cell membrane?

A. Lipids; B. Carbohydrates; C. Protein; D. Nucleic Acids

A. Lipids

Which macromolecule makes up butter?

A. Lipids; B. Carbohydrates; C. Protein; D. Nucleic Acids

A. Lipids

Which macromolecule makes up DNA?

A. Lipids; B. Carbohydrates; C. Protein; D. Nucleic Acids

D. Nucleic acid

What are the 5 steps of the scientific method

1. Observe

2. Hypothesize

3. Experiment

4. Analyze

5. Share

Describe the observation step of the scientific method

Use the 5 senses to note a detail, fact, or occurrence

Describe the hypothesis step of the scientific method

Develop a testable prediction based on prior observation and knowledge

Describe the experimentation step of the scientific method

Conduct experiment, with controls, repeat

Describe the analysis step of the scientific method

Evaluate findings, quantify data

Describe the sharing step of the scientific method

Share findings with like-minded individuals

How do enzymes speed up reactions?

Lowering activation energy

Identify how many protons, electrons, and neutrons nitrogen has

Protons- 7; Electrons- 7; Neutrons- 14

Identify how many protons, electrons, and neutrons phosphorus has

Protons- 15; Electrons- 15; Neutrons- 30

Is baking soda (pH 9) basic, acidic, or neutral?

Basic

Is vinegar (pH 2.5) basic, acidic, or neutral?

Acidic

Is water (pH 7) basic, acidic, or neutral?

Neutral

Which of the following determines how an atom interacts with other atoms?

A. Protons; B. Electrons; C. Neutrons

B. Electrons

Which of the following determine an atoms identity?

A. Protons; B. Electrons; C. Neutrons

A. Protons

Which of the following adds to an atoms weight but does not determine an atoms identity?

A. Protons; B. Electrons; C. Neutrons

C. Neutrons

What is peer review?

A process by which a group of experts evaluate a report and determine if it is high enough quality to publish in a scientific journal

What are the 5 properties that make water so amazing?

Adhesion, cohesion, high heat capacity, universal solvent, less dense in solid form

Which property of water makes most substances easily dissolvable in water?

Universal solvent

Which property of water means organisms can survive in liquid water below ice?

Less dense in solid form

Which property of water creates surface tension?

Cohesion

Which property of water makes water release a large amount of energy as it cools?

High heat capacity

Which property of water makes water able to move easily?

Adhesion

What type of bond does water make with other water molecules?

A. Ionic; B. Covalent; C. Hydrogen; D. Mutualistic

C. Hydrogen

What type of bond does hydrogen make with oxygen to form water molecules?

A. Ionic; B. Covalent; C. Hydrogen; D. Mutualistic

B. Covalent

Which of the following is NOT considered a lipid?

A. Steroids; B. Phospholipids; C. Cellulose; D. Lard

C. Cellulose

Which of the following is NOT considered a carbohydrate?

A. Sucrose; B. Chitin; C. Galactose; D. Phospholipids

D. Phospholipids

Which of the following is NOT a reason or cells to divide?

A. Growth; B. Reproduction; C. Replacing dead/damaged cells; D. Strength

D. Strength

Which of the following groups does NOT have a cell wall?

A. Bacteria; B. Plants; C. Fungi; D. Animals

D. Animals

Which type of cell division creates four genetically unique gametic daughter cells?

Meiosis

Which type of cell division creates two genetically identical somatic daughter cells?

Mitosis

Which of the following is NOT a characteristic shared by all living organisms?

A. Homeostasis; B. Growth; C. Breathing; D. Evolution; E. Producing waste

C. Breathing

True or False?

Cancer can be easily avoided once a cure is found

False

True or False?

Centrioles control spindle fibers during mitosis

True

True or False?

DNA is replicated during the G1 phase of interphase

False

True or False?

Cancer occurs when cells divide uncontrollably during meiosis

False

In DNA, the D stands for what?

A. Dextrose; B. Deoxyribose; C. Diamer sucrose

B. Deoxyribose

Under what circumstances does cancer occur?

A. Mutations build up knocking out checkpoints and tumor suppressing genes

B. When you are of advanced age

C. Cell division occurs out of control

D. All of the above

E. A&C only

E. A&C only

What kind of fat is liquid at room temp, and includes kinked hydrocarbon chains with one or more single or double bonds?

A. Saturated; B. Unsaturated; C. Trans; D. Hydrogenated

B. Unsaturated

What kind of fat is solid at room temp, and includes unkinked hydrocarbon chains with single bonds only?

A. Saturated; B. Unsaturated; C. Trans; D. Hydrogenated

B. Saturated

What part of the cell does a prokaryotic cell lack?

A. Ribosomes; B. Cell wall; C. Cell membrane; D. Golgi apparatus

D. Golgi apparatus

Why?

Prokaryotic cells lack membrane-bound organelles

Which if the following is NOT present in all cells?

A. Nucleus; B. DNA; C. Ribosomes; D. Cell membranes

A. Nucleus

Why?

Prokaryotic cells have no nucleus

What part of the cell processes fats, sugars, and toxins?

A. Rough ER; B. Smooth ER; C.Mitochondria; D. Golgi apparatus

B. Smooth ER

Which of the following is true of enzymes?

A. They are a class of proteins

B. They speed up chemical reactions

C. They are made of ribosomes

D. All of the above

D. All of the above

True or False?

According to the currently accepted definition of life, viruses are considered living

False

True or False?

Bias is hoping for a particular outcome

True

True or False?

Running an experiment once or twice is sufficient for accurate data

False

True or False?

A control group is the group being manipulated to test for an outcome

False

True or False?

In a double blind experiment, neither the experimenter nor the participant know who is in the test group or placebo group

True

Which of the following is an example of homeostasis?

A. A fungus attacking a population of insects that has grown out of control

B. Consuming an excessive amount of pizza

C. A bird excreting a salty tear to lower the body’s salt content

D. An exterminator killing pests in a home

C. A bird excreting a salty tear to lower the body’s salt content

Which subatomic particle is negatively charged, and can be passed or shared between atoms?

A. Protons; B. Electrons; C. Neutrons

B. Electrons

Which subatomic particle is positively charged?

A. Protons; B. Electrons; C. Neutrons

A. Protons

Which subatomic particle has a neutral charge?

A. Protons; B. Electrons; C. Neutrons

Neutrons

Name this phase of mitosis

Telophase

Name this phase of mitosis

Prophase

Name this phase of mitosis

Anaphase

Name this phase of mitosis

Metaphase

List in order of magnitude:

Egg cell, mitochondria, giraffe, carbon atom, adenine molecule, basketball

Carbon, adenine, mitochondria, egg cell, basketball, giraffe

Label the photosynthesis diagram with the following; Oxygen (O2), Carbon Dioxide (CO2), Glucose (C6H12O6), Water (H2O)

A- Water (H2O)

B- Carbon Dioxide (CO2)

C- Oxygen (O2)

D- Glucose (C6H12O6)

Label the cellular respiration diagram with the following: Oxygen (O2), Carbon Dioxide (CO2), Glucose (C6H12O6), Water (H2O), ATP

A- Glucose

B- Oxygen (O2)

C- Water (H2O)

D- ATP

E- Carbon Dioxide (CO2)

What is the function of a ribosome?

Protein synthesis

What is the function of a cell wall?

Structure in plant cells

What is the function of a cell membrane?

Protect genetic information

What is the function of an organelle?

Functional unit of the cell

What is the function of the smooth endoplasmic reticulum?

Processing nutrients, detoxifying poisons/alcohol

What is the function of the rough endoplasmic reticulum?

Management of intracellular and extracellular transportation

What is the function of the Golgi apparatus?

“Mailroom” distribution center

What is the function of the vesicles?

Packaging extracellular material

What is the function of the central vacuole?

Water supply for plant cells

What is the function of the chloroplasts?

Energy processing for plant cells

Who is the less credited co-father of evolution?

A. Charles Darwin; B. Alfred Wallace; C. Jean Batiste Lamarck; D. Charles Lyell; E. Gregor Mendel

B. Alfred Wallace

Who came up with the uniformitarianism “use it or lose it” theory of evolution?

A. Charles Darwin; B. Alfred Wallace; C. Jean Batiste Lamarck; D. Charles Lyell; E. Gregor Mendel

C. Jean Batiste Lamarck

Who is considered the father of inheritance?

A. Charles Darwin; B. Alfred Wallace; C. Jean Batiste Lamarck; D. Charles Lyell; E. Gregor Mendel

E. Gregor Mendel

Who is the often credited co-founder of evolution?

A. Charles Darwin; B. Alfred Wallace; C. Jean Batiste Lamarck; D. Charles Lyell; E. Gregor Mendel

A. Charles Darwin

Who is the geologist who asserted the theory that the Earth is millions of years old?

A. Charles Darwin; B. Alfred Wallace; C. Jean Batiste Lamarck; D. Charles Lyell; E. Gregor Mendel

D. Charles Lyell

Put the following elements of protein synthesis in order: transcription, translation, RNA, DNA

DNA → Transcription → RNA → Translation

What are the 3 main differences between DNA and RNA

1. DNA is double-stranded; RNA is single-stranded

2. DNA is deoxyribose; RNA is ribose

3. DNA has thymine; RNA has uracil

Create a complementary strand: ACAGTCGAT

TGTCAGCTA

Create an mRNA strand: ACAGTCGAT

UGUCAGCUA

What is the functional role of RNA polymerase?

A. Extracting exons

B. Transcription

C. Translation

D. Deoxyribose nucleic acid duplication

B. Transcription

What is the functional role of DNA polymerase?

A. Extracting exons

B. Transcription

C. Translation

D. Deoxyribose nucleic acid duplication

D. Deoxyribose nucleic acid duplication

What is the functional role of a spliceosome?

A. Extracting exons

B. Transcription

C. Translation

D. Deoxyribose nucleic acid duplication

A. Extracting exons

What is the functional role of a ribosome?

A. Extracting exons

B. Transcription

C. Translation

D. Deoxyribose nucleic acid duplication

C. Translation

Convert the mRNA strand into an amino acid chain :

AUGGUUGAGCGUACAUAUUGA

MET-VAL-GLU-ARG-THR-TYR-STOP

What kind of selection created the corn we have today?

A. Natural selection

B. Sexual selection

C. Artificial selection

D. Acquired selection

C. Artificial selection

Label the diagram of translation with one of the following:

1. mRNA

2. tRNA

3. Codon

4. Anticodon

5. Amino acids

6. Polypeptide (amino acid chain)

7. Ribosome

A. mRNA

B. Anticodon

C. Amino acids

D. tRNA

E. Polypeptide (amino acid chain)

F. Codon

G. Ribosome

Order the following by size; gene, chromosome, nucleotide, codon

nucleotide, codon, gene, chromosome

Droughts and floods are considered which kind of stressor that encourages natural selection?

A. Predation; B. Sexual Selection; C. Physiological Stress; D. Competition

C. Physiological Stress

Who published “On the Origin of Species” in 1859, first describing natural selection?

Charles Darwin

What type of evolutionary evidence is this?

The fossil record

Which type of evolutionary evidence does the following definition describe: “Large events that wipe out many creatures, allowing a new set of living beings to flourish”

A. Catastrophism

B. Uniformitarianism

A. Catastrophism

Which type of evolutionary evidence does the following definition describe: “Slow, gradual changes continuously amounting to large changes over large periods of time”

A. Catastrophism

B. Uniformitarianism

B. Uniformitarianism