Gene Expression Study Guide (BIO 161)

Genes

Units of genetic information (DNA) that carry instructions for building polypeptides (proteins) or functional RNA molecules along with regulatory sequences

Gene Expression

Process of converting archived information into molecules that actually do things

The Central Dogma of Molecular Biology

Summary of the flow of information in cells

Transfer RNA (tRNA)

"Interpreter" molecule; transfers amino acids to the ribosomes

Ribosomal RNA (rRNA)

Component of RNA

Information flow is always in one direction

False. In some cases, information flows from RNA back to DNA

How many nucleotide bases are there?

4 (A,T,G,C)

How many amino acids do the nucleotide bases specify?

20

Triplet Code

Each amino acid is code for by a group of three bases

Codon

Group of three bases that specifies a particular amino acid

Start Codon

Identifies the site at which protein synthesis should start; codes for methionine (AUG)

Stop Codons

Signify that protein synthesis is complete (UAA, UAG, UGA0

What does it mean when genetic code is redundant?

More than one triplet may specify the sam amino acid

What does it mean when genetic code is unambiguous?

Each codon has only one meaning

What does it mean when genetic code is conservative?

First two bases of codons that specify the same amino acid are usually identical

What does it mean when genetic code is universal?

The same genie code is used by all living things

Translate this template strand:

3' - CGTACCAGTTCGCATCGATTT - 5'

5' - GCAUGGUCAAGCGUAGCAAA - 3'

Mutation

Any permanent change in an organism's DNA

Point Mutation

Replacement of one nucleotide with another (Silent, Missense, Nonsense)

Silent Mutation

Does not alter amino acid sequence

Missense (Substitution) Mutation

Changes one amino acid to another

Nonsense Mutation

Changes codon for an amino acid to STOP codon (polypeptide chain to short = non functional protein)

Frameshift (Insertion or Deletion) Mutation

Alter reading frame (group of codons) of mRNA triplets resulting in non-functional protein

Chromosomes

DNA and proteins (histones) packed together

Double Helix

Two polynucleotide strands, twist about one another with a sugar-phosphate backbone

Complementary Base Pairing

Bases hydrogen bond with one another (A pairs with T, G pairs with C)

DNA Replication

Making a copy of the DNA in a cell

How does DNA replicate?

DNA unwinds and unzips where a old strand serves as a template and complementary nucleotides are added to form a new strand

Daughter Strands

Identical to parent helix containing one old strand and one new strand

What is the complementary strand for the template strand?

5' - ATCCTCG - 3'

3' - TAGGAGC - 5'

DNA Polymerase

Catalyzes the addition of nucleotides to existing 3'-OH groups

Does DNA polymerase require a primer?

Yes

Primers

Short RNA starters are synthesized by primase (an RNA polymerase)

Prokaryotes

Single origin of replication

Eukaryotes

Multiple points of orgin

What direction does DNA synthesis occur?

5' to 3' direction

Helicase

Catalyzes the breaking of hydrogen bonds between base pairs and the opening of the double helix

Topoisomerase

Breaks and rejoins the DNA double helix to relieve twisting forces caused by the opening of the helix

Primase

Catalyzes the synthesis of the RNA primer

DNA Polymerase III

Extends the leading strand

Lagging Strand Synthesis

Discontinuous; synthesize a series of 100-200 bp Okazaki fragments

DNA Polymerase I

Removes the RNA primer and replaces it with DNA

DNA Ligase

Catalyzes the joining of Okazaki fragments into a continuous strand

What are some problems that can occur with DNA Synthesis?

Chromosome shortening, mismatched bases, damages bases

Telomeres

The ends of linear chromosomes

Telomerase

Replicates the ends of chromosomes

Mismatch Repair

DNA polymerase can repair mismatched bases after replication

Nucleotide Excision Repair

Removes and fixes damaged or wrong nucleotides (bases)

Transcription

Process by which messenger RNA (mRNA) is made from a DNA template

Translation

Process by which proteins and peptides are synthesized from mRNA

What direction is new RNA strand "built"?

5' to 3'

What direction does RNA polymerase travel along DNA template strand?

3' to 5'

Where does RNA polymerase begin transcribing?

At a promoter

Promoter

Part of DNA, initiation site of transcription

What are transcription factors and what do they do?

They are proteins, bind to promote region of DNA, and recruit RNA polymerase II

Transcription initiation in Prokaryotes

Sigma factors bind to promoter

Transcription initiation in Eukaryotes

Basal Transcription Factor binds to promoter, and Regulatory Transcription Factor binds to enhancer; together they recruit RNA polymerase

RNA Polymerase

Opens the helix; transcription begins (does not need a primer)

Transcription elongation

Sigma factor/transcription factor is released: RNA polymerase moves along DNA 3' -> 5', synthesizing RNA in the 5' -> 3' direction

Transcription termination in Prokaryotes

Transcription stops when RNA polymerase reaches a termination sequence (codes for RNA that forms a hairpin)

Termination in Eukaryotes

Transcription termination is triggered at poly(A) signal sequence; then a tail of hundreds of "A" is added to the mRNA

Relationship between transcription and translation in Prokaryotes

Transcription and translation are tightly coupled

Relationship between transcription and translation in Eukaryotes

Transcription and translation are separated in space and time

Which cell uses mRNA processing?

Eukaryotes

mRNA Processing

Occurs in the nucleus before mRNA is exported to the cytoplasm for translation

What happens in mRNA processing?

Addition of 5'-cap, addition of 3'-polyA tail, removal of introns

5'-cap

Composed of modified guanine nucleotide; serves as a recognition signal for translation machinery (ribosome)

3'-poly(A) tail

Composed of 100-250 adenine nucleotides; facilitates transport out of nucleus; protects mRNA message from degradation in the cytoplasm

Exons

Expressed (coding) regions

Introns

Intervening (noncoding) regions

RNA Splicing

Sp.icing is catalyzed by small nuclear RNAs and small nuclear ribonucleic proteins - snRNAs and snRNPs

What does splicing form?

A multiprotein complex called spliceosome

tRNA Structure

Made up of about 80 nucleotides of RNA that was transcribed from DNA

Are all tRNA's alike?

NO

Anti-codons

Pair with codons which determines what amino acid gets attached on top of tRNA

Aminoacyl-tRNA Synthestase

Enzyme that reads the anticodon on the tRNA and then puts the correct amino acid on

Does aminoacyl-tRNA synthetase require ATP?

Yes

Are aminoacyl-tRNA synthetase specific?

Yes they are specific for each amino acid and its tRNAs

Ribosome

Site of protein synthesis; composed of ribosomal RNA (rRNA) and proteins

Small subunit (in ribosomes0

Holds mRNA in place

Large subunit (in ribosomes)

Has three binding sites for tRNAs: contains active site for peptide bond formation

E (exit) Site

Holds tRNA that will exit (amino acid no longer attached)

P (peptide) Site

Holds the tRNA with growing polypeptide attached

A (amino acid) Site

Holds incoming tRNA (with attached amino acid)

Translation initiation

1. mRNA binds to small subunit of ribosome 2. Initiator aminoacyl tRNA binds to start codon 3. Large subunit of ribosome binds, completing ribosome complex

Translation elongation

1. Arrival of tRNA/amino acid 2. Peptide-bond formation 3. Translocation

Arrival of rRNA/amino acid (translation elongation)

Appropriate tRNA (carrying an amino acid) binds to the mRNA code in the A site via complementary base pairing

Peptide bond formation (translation elongation)

Peptide chain is covalently linked to amino acid in the A site

Translocation

Ribosome moves down the mRNA (5' to 3'), moves empty tRNA into E site, moves tRNA containing polypeptide into P site, opens A site exposes new mRNA codon

What stops the translation elongation process?

When a ribosome encounters a stop codon

Translation termination

Stop codon in A site -> protein release factor enters A site, bond linking p site tRNA with polypeptide is hydrolyzed; polypeptide is released from ribosome, small and large subunit of ribosome and mRNA dissociate

In prokaryotes...

Translation begins before transcription is complete

In eukaryotes..

Transcription and translation are separated in space and time

Post-translational modification

Folding, modification (in Golgi), activation, degradation

Importance of Regulated Gene Expression

Allows cells to respond to environmental changes, improves efficiency, allows for cell differentiation

constitutively expressed genes

Genes that are needed and expressed all the time

Mechanisms of Regulation: Prokaryotes

DNA -> mRNA -> protein -> active protein

Transcriptional Control

Slow response, very efficient

Translational Control

Fast response, less efficient

Post-Translational Control

Fastest response, least efficient