PharmacoKinetics Part 1

Personalized/ Precision medicine takes into account an individuals _______, ______ , and _____ when figuring out the best therapy for them

genes

proteins

ENVIRONMENT

how are we able to separate patient populations to individualize their therapy? (identify genetic variation among patients)

• biomarkers (what is a internal pattern we are seeing in certain individuals with the disease vs others)

• companion diagnostics

how have we targetted treatment?

paying attnetion to the genes, proteins, and envrionements of RESPONDERS vs NONrespononders

what are the GOALS of personalized medicine

1. right PATIENT

2. right DOSE

3. right TIME

increase efficacy and safety

what are biomarkers used for ?

they can be indicative of

• normal biological processes

• pathogenic processes

• pharmacologic response to therapy

anything in your body that you can track to see if your body is functioning normally, signs of disease, or how you are responding to a medication

biomarkers have led to treatment advancements in which fields?

what is an example of a biomarker?

• oncology

• HIV/AIDS

• neurosceince

• cardiovascular

ex. prostate specific antigen (prostate cancer)

biomarker information is contained in about _____% of FDA approved ONCOLOGY drug labels between 2015-2019

in ALL areas the inclusion of biomarkers has increased with about _____% of new drugs in 2020

60%

28%

which of the following is true regarding biomarkers?

• results play an important role in identifying therapeutic outcomes

• may categorize responders vs nonresponders

• maximize safety and efficacy

• all of the above

all of the above

what impacts the phenotype?

1. genotype

2. environmental factors

3. development

are the following characteristics of the phenotype or genotype?

• specific alleles

• inheritance

• genetic makeup of organism

genotype

a genetic variant is a difference in the ________ sequence

• reference

• wild type

• ancestral

Which is mutation vs which is polymorphism?

• changes in a DNA sequence away from normal

• variations in the DNA sequence that associates with populations

• mutation

• polymorphism

Polymorphism vs. Mutation

are genetic variants through mutations or polymorphisms more common?

are mutations somatic, germline, or both?

are polymorphism somatic, germline, or both?

polymorphism more common

mutation is both somatic and germline

polymorphism ONLY germline (inherited)

can mutations in tumors be inherited?

NO

normal references are unclear for polymorphisms so _____ vs _____ allele based on ________ within a population

major vs minor

frequency

are polymorphisms a single nucleotide switch?

no, they can be a variety of gene changes

substituting one nucleotide for another nucleotide

single nucleotide POLYMORPHISM

add or remove one or more nucleotides

indel

a SNP with one reference allele and one variant allele is called ________

a SNP with both alleles changes is called

heterozygous

homozygous

do SNPs occur only in coding regions?

NO can also occur in noncoding regions

do SNPs typically alter protein funciton and change phenotype?

NO SNPs are very common and less than 1% of people will experience change in protein function or phenotype

a SNP in a noncoding region may lead to increased/decreased/ both gene expression

single nucleotide polymorphism can lead to both increase and decreased gene expression (both lead to cancer)

• increased expression of protooncogene

• decreased expression of tumor suppressor gene

how can SNPs alter mRNA?

can change AMOUNT of mRNA made and/or STABILITY of mRNA

what is the difference between a

• nonsense

• missense

• synonymous

single nucleotide polymorphism

nonsense = change in single nucleotide codes for premature stop codone

missense= change in single nucleotide codes for different amino acid

synonymous= change in single nucleotide still codes for same amino acid

UCA = serine

UCG = serine

the SNP from UCA —> UCG is an example of __________ substitution

synonymous substitution

GAG= glu

UAG= stop

the SNP from GAG—> UAG is an example of __________ mutation

nonsense

ACG= thr

CCG= pro

the SNP from ACG—> CCG is an example of __________ mutation

missense mutation

short sequences of genomic DNA that are repeated numerous times in a row

tandem repeat polymorphism

what are the two different types of tandem repeat polymorphisms?

microsatellites/ short tandem repeats = less than 5 basepairs that are repeated

minisatellites = more than 5 basepairs that are repeated

is CATCATCATCATCATCATan example of a microsatellite tandem repeat or a minisatellite tandem repeat?

microsattelite bc/ only 3 basepairs are continuously repeated

CATGCTCATGCTCATGCTCATGCT

is this an example of a microsatellite or minisatellite tandem repeat?

since there are 6 base pairs that are repeated (CATGCT) which is more than 5 this is a minisatellite

how many times does the TATA box of the promotor region repeat for UGT1A1 promoter?

what happens if there is an decreased or increased number of the repeat?

6 repeats

if more or less will lead to GILBERTS SYNDROME - Hyperbullimineria

genetic disorder caused by a variable number of TA repeats in UGT1A1

Gilbert’s Syndrome (Hyperbullimineria)

segment of DNA in which a variable number of that segment has been found in one or more populations

caused by genomic variations such as ________, ________, _________

LARGE SEGMENT FROM 10³ to 10^6 base pairs

copy number varient

duplications, deletions, inversions

true/false: CNV occurs in ____% of the human genome

10

Gene Multiplication/ Amplification:

what happens when CYP2D6 is duplicated?

since CYP2D6 is 5.2kb long a duplication in this gene is considered a _____ ______ variant

gene is amplified

copy number varient bc/ it is between 1kb -1mega base

if the number of nucleotides added or lost is not a multiple of ______ , the reading frame of the gene is disrupted leading to a frameshift mutation

3

would a deletion of 9 nucleotides lead to a frameshift, why or why not?

how about a deletion of a single nucleotide?

NO since 9 is a multiple of 3 some amino acids will be deleted and changed but not the ENTIRE sequence (the end should remain the same)

YES since 1 is not a multiple of 3, every single codon will be different

a 50Kb deletion from the GSTM1 gene in germline can lead to a 50% _______ in glutathione conjugating capability

other GSTM enzymes can also have gene deletions

reduction

one of two (or more) forms of a DNA sequence that is located at a specific position on a specific chromosome

allele

what is the difference between a major and minor allele?

major - normal/reference/ancestral/wildtype allele

minor- variant/polymorphic allele

the combination of alleles a person carries at a particular location in DNA

there are ___ copies of every chromosome/gene

one from ______ one from ________

if the alleles on both of the chromosomes match they are _______

if the alelles on both of the chromosomes are diferent they are _______

genotype

2

mother father

homozygous

heterozygous

how are alleles numbered?

*1

*2

*3…

wild type is always *1

does a mutant allele always lead to a loss of function the wild-type?

NO

can also be gain- of- function

what is a null allele ?

deleted gene

CYP2B6 c.516G>T

• is this a single gene mutation or a protein mutation? how do you know?

• what does the 516 represent?

• was the wildtype guanine or thymine?

• gene mutation (c. stands for coding sequence)

• 516 is the position within the gene that the nucleotide was replaced

• wildtype is guanine SNP to thymine

CYP2B6 p.Q172H or CYP2B6 p.162Q>H

• is this a single allele mutation or a amino acid mutation? how do you know?

• what does 172 stand for?

• which is the wildtype? which is varient?

• change in amino acid (p. for protein if c. would be allele)

• 172 is the position of the amino acid change

• Glutamine (Q) is wildtype Histidine (H) is variant

each varient is provided with a ______ ________ ______(___) for identification and searching

which institution coordinates these numbers?

which database are these numbers kept in?

reference SNP number (rs)

NIH

dbSNP database

measurable characteristic of an organism

phenotype

what are pharmacologic examples of phenotypes?

1. metabolism (extensive vs poor metabolizers)

2. AUC, Cmax, Cl (pharmacokinetics)

3. responder vs non-responder (pharmacodynamics)

what is the difference between Dominant-Recessive traits vs Additive/Co- Dominance

if you have heterozygous alleles for dominant-reccccesive traits you will get the dominant genotyope —> phenotype (Rw will give you dominant red rose)

if you have heterozygous for additive/co- dominance —> you will get a hybrid genotype —> phenotype (Rw will give you mix of dominant red and recessive white —> pink rose)

True/False: allelele and genotype frequencies in a population will remain constant from generation to generation in the absense of other evolutionary influences

TRUE

this is why we can use to the hardy-Weinberg equation to estimate how many people will be heterozygous or homozygous

what is the equation for allele frequency?

p+q= 1

p= frequency of major allele

q= frequency of minor allele

what is the equation for genotype frequency?

p² + 2pq+ q² =1

all the different possibilities must equal one

p² + 2pq+ q² =1

is this the phenotype or genotype equation?

genotype equation

p² = frequency of homozygous major alleles

q² = frequency of homozygous minor alleles

pq = frequency of heterozygous major and minor alleles

given p= 0.67 and q=0.33

and the alleles are in equilibrium since 0.67+0.33= 1

what is the frequency of homozygous of major allele?

what is the frequency of homozygous minor allele?

what is the frequency of heterozygous minor and major allele?

• homozygous (major) = (0.67)² = 0.4489 = 44.89% of the population will have major phenotype

• homozygous (minor) = (0.33)² = 0.1089 = 10.89% of the population will have the minor phenotype

• heterozygous = 2(0.67×0.33) = 0.4422= 44.22% of the population will have heterozygous phenotype

p= 0.4 and q= 0.6

when testing the percentage of individuals of a population with the minor phenotype, a scientist found that the percentage of individuals with the homozygous minor allele phenotype was 0.218

are these genotypes in equilibrium? if not, what should the percentage be?

why might this be the case?

genotypes are NOT at equilirium minor allele phenotype should be 0.6² = 0.36

this may be due to

1. did not test on a large enough population

2. mating in the popuilation is not random (inbreeding)

3. genotyping error in lab

p=0.9 q=0.1

the percentage of individuals with heterozygous phenotype in this population is 0.18

do you suspect any breeding in this population?

what else would you suspect?

NO

2pq = 0.9×0.1 = 0.18 which does not deviate from expected frequency

study must have been done correctly in a large population

no genotyping errors in lab

combination of alleles found at a linked locus on a chromosome that are inherted together as a block (combinations of SNPs that encode for a persons gene)

haplotype

representation of the alleles for a specific gene on both chromosomes of a pair

ex. the gene that encodes for the enzyme CYP2D6 with allele 3 and one chromosome and 5 on the other would be denoted CYP2D6 *3/*5

diplotype

when two SNPs at different loci are associated with each other, they are considered to be in ________ __________

linkage disequilibrium

what does a 0.98 linkage disequilibrium score mean between two SNPs mean?

if you have one SNP you are 98% likely to have the other

representative SNP in a region of the genome with high linkage

can be used to identify haplotype blocks

TAG-SNP

explain how a Tag-SNP can be used to identify haplotype blocks

Tag-SNPs are polymorphisms that are often found together

if you know that there is a G in position 3 you can predict the nucleotide before and after the G because they often are mutated together

Phenotype to Genotype Study Design:

• start with ______ ______ (measurable) between two groups of subjects

• look at _____ to determine which ______ are repsonsible FOR the phenotype

• need small/large number of subjects

• drug response

• genetics genes'

• large

Explain phenotype to genotype study design

gather large population of patients who responded similarly to a drug and try to figure out which genes played a role in their response

Genotype to Phenotype

• start with two groups of subjects with _______differences in a SPECIFIC ______

• give a probe ______

• measure _____or _____

• small/large population needed

genetic gene

drug

PK or PD

large

Explain genotype to phenotype study design

gather a small group of individuals with DIFFERENCES in a specific gene

give them a drug

measure and observe differences in how people responded to drug (PD) and how the drug responded to their body (PK)

study of variability in drug response (efficacy or toxicity) determined by single genes—monogenic response

pharmacogenetics

study of variability in drug response (efficacy or toxicity) determined by multiple genes within the genome—polygenic response

pharmacogenomics

what is the difference between pharmacogenetics and pharmacogenomics?

genetics = how a single gene impacts drug effectiveness/toxicity

genomics= many genes contribute to the effectiveness/toxicity of a drug

what is the distribution pattern of a monogenic trait vs multigenic trait?

monogenic = trimodal distribution

multigenic = unimodal

explain why a monogenic trait would have a trimodal distribution while a monogenic trait would have a unimodal distribution

if you are looking at a single gene you can observe the effect of homozygous minor (small), heterozygous (intermediate), and homozygous major (large)

for a multigenic traits there are combinations of genes that coorespond to drugs, there will be one large peak for the specific combination of genes that cause the greatest effecacy/ toxicity

in 1988: US Congress commissioned ___and ____

to implement the ______ ________ _______

1990: _______ began

_____: completion of project!

• 50 years after the discovery of the double helix

Freely accesible data is now available at the National Center for ________ ___________

DOE and NIH Human Genome Project

Mapping

2003

Biotechnology Information

establish common patterns of VARIATION in human DNA sequences to discovery genetic factors influencing VULNERABILITY to DISEASE and drug response

database of common patterns of hertiability in human genome

identified inhertited regions using ________ rather than sequencing entireee gene region

this project was ended and replaced with __________

international HapMap Project

tag-SNP

comprehensive catalog of LESS COMMON genetic vatiants in 2,500 individuals from 5 global regions (spanning 26 populations)

used state-of-the-art WHOLE genome sequencing called “ ________ _______” or “_______ “________

1000 Genome Project

Next Generation or Deep Sequencing

the goal of the 1000 genome project was to find less common gene variants in 2500 individuals

in order to achieve this goal and determine a person’s genomic sequence, ________ were made and sequenced and then ________ with reference

during an initial read MULTIPLE regions would be missed while sequencing

therefor, one needs to do _______ ______/ ______ ________

• ______ X depth sequencing allows deteciton of MOST varients that are frequent in at least 1% of the population

• ________X depth or higher needed for entire genome and distibguish between to alleles

fragments realigned

multiple rounds of fragmentation and realigning sequence with reference are needed to detect less common variants

the more/less rounds of sequencing the rarer the varient

____ X depth sequncing allows detection of most varients that are found in at least 1% of the populayopn

_____X depth or higher needed to exntire genome and distinguish between two alleles

more rounds = greater rarity in genetic variant

4x

28x

NIH program to enrol at LEAST 1 million participitants to understand how

• genomics

• sex

• environemntal exposures

• biomarkers

can reveal new ways to personalize medicine across all diseases

all of us

Peer reviewed guidelines that enable “translation of genetic lab test results into actionable prescribing decisions for specific drugs”

• focusus on _____ or ______

• helps clinicians understand _____ available genetic test results should be used to optimize drug therapy rather than whether they should be ordered

Clinical Pharmacogenetics Implementation Consortium (CPIC)

gene or drug

HOW

what information are you hoping to find out of Clinical Pharmacogenetic Implementation Consortium (CPIC)?

what information do you already have before going onto the website?

CPIC will help you determine whether or not your patient should adjust their prescriptions based on their genetic lab results

before you get onto CPIC you should be prepared with patients genetic results. goal is to check if their mutations will cause a problematic change in PK or PD

If a pharmacist is struggling to determine whether or not they should preform a genetic test on their patient, should they go to CPIC?

NO

pharmacists go on CPIC after they have already gotten results back and are looking to see if there will be any issues with the medications they are trying to prescribe to the patient

Explain the different CPIC Levels of Evidence from A to D

A- based on your patent’s genetic lab results, you SHOULD change their prescription

B- based on your patients genetic lab results you COULD change their prescription

C and D- based on your patients genetic lab results, there shouldn’t be a prescibing issue, they should be safe to stay on their medication

the 24 clinical guidelines for prescribing drugs based on patients pharmacogenetic profile found from labs are included within which level of evidence, why does that make sense?

level A -

guidelines are provided when your patient SHOULD be changing their prescription based on their lab results

when would you use CPIC?

1. determine how important a gene is for a drug response (A-D)

2. how to interpret and act based on patients genetic profile

a pharmacist took a genetic lab test and found that their patient has a diplotype of *2 / *5 for their CYP2D6 gene

they want to know whether or not its safe for the patient to take codeine and how much codeine the patient took take

should the pharmacist use the resource CPIC or PharmGBK?

since he already has patient genetic information he should use CPIC

when searching up the CPIC level of evidence for codeine and CYP2D6 the result came out to be level A.

How would you define the FDA PGx label?

FDA- Actionable PGx

if a patient has a mutation in CYP2D6 it may singiifcantly impact the metabolism of codeine as seen by the level of evidence A

so CPIC can provide a course of action based on their 26 guidelines

comprehensive resource that curates knowledge about the impact of genetic variation on drug response for clinicians and researchers

pharmGKB

pharmacogenomic knowledge base

what are the 4 different tabs within PhamGKB that you can research under?

1. annotated drugs

2. curated pathways

3. clinical guideline annotations

4. drug label annotations

what would you expect to see if you went into the “curated pathways” tab of the PharmGKB website for warfarin ?

You would see the pathways of pharmacokinetics (which metabolites are at work)

You would also see the different mechanisms of action and how the body responds to the drug (pharmacodynamics)

what would you expect to see if you went into the “clinical guideline annotations” tab of the PharmGKB website for warfarin ?

you would be able to access CPIC and insert patient’s genetic diplotypes and see how that would impact drugs PK and PD

what would you expect to see if you went into the “drug label annotations” tab of the PharmGKB website for warfarin ?

recommendations by regulatory agencies such as the FDA, EMA, SWISSMEDIC

will tell you if testing is required or if they have an actionable PGx

When would you use Pharm GKB?

1. look up general drug or ______ information

2. determine which ____ and ____ pathways are important for your drug (visual depictions)

3. access ______ guidelines in a simplified format, often with dropdown selections to determine actions you should take based on patients’ _______

4. determine whether FDA requires ______ _________, whether there is actionable or just informative genetic information available

1. varient

2. PK and PD

3. CPIC diplotype

4. genetic testing

would you be able to find information on which population has the highest allele frequency for the reference and variant allele be found on CPIC or PharmGKB?

PharmGKB