Lecture Two Pt. 2: Macromolecules

Water and Life

• Water is the most prevalent molecule within living things

• Many things dissolve in water

  • Most chemical reactions within an organism occur in a water environment

How salt dissolves in water

• The Na+ and Cl- separate and are each surrounded by spheres of water molecules 

  • Water’s partially negative oxygen atoms attract Na+ ions 

  • Water’s partially positive hydrogen atoms attract Cl- ions

Ice and Life

• As the temperature of water decreases, hydrogen bonds are not broken as fast 

• The density of ice is less compared to liquid water 

• Thus, ice floats on top of water 

• The water beneath is insulated

• Entire bodies of water do not freeze solid

• This affords a warm environment for organisms such as fish, invertebrates, and other organisms

Water and Heat

• Oceans absorb and release heat

• Water also acts as a heat buffer in our body 

• Heat is absorbed by the water in our bodies

• Sweating releases heat

Hydrophilic

• “water-loving”

• Possess charges (partial or complete)

• Most of the molecules within cell compartments are hydrophilic 

Hydrophobic

• “water fearing”

• Do not possess charges

• Some of these molecules are important to life

• Hydrophobic molecules are important in forming cell compartments

Cells in your body and other living organisms are…

• compartmentalized 

• Water is prevalent within and outside of these compartments

• Some molecules both hydrophilic and hydrophobic regions

Acids

• Damaging to living tissue

• increases H+ concentration

• yields H+ when placed in water

• Has low pH (pH < 7)

Bases

• Damaging to living tissue

• decreases H+ concentration

• accepts H+ when placed in water

• Has high pH (pH > 7)

pH

• measure of the degree to which a substance is acidic or basic

• measurement of hydrogen ion (H+) concentration

• Logarithmic

  • A substance with a pH of 9 is ten times as basic as a substance with a pH of 8 

  • A substance with a pH of 2 is 100 times more acidic than a substance with a pH of 4 

• From 0 to 14 (7 is neutral - H2O has pH of 7)

Living things are…

• sensitive to changes in pH

  • A change in pH can change the shape of various molecules 

    • Ex. enzymes

  • Altered shape can reduce function

Many organisms have acid-base buffering systems

• Systems that keep pH within normal limits

• The stomach can become too acidic 

  • Result is indigestion (“heartburn”)

• Antacids raise the pH of the stomach 

  • Bases in the antacids neutralize acids

  • Ex. Sodium bicarbonate (baking soda), calcium carbonate(chalk), Aluminum hydroxide, etc.

Common Acids and Bases

• Some parts of the human body have special pH requirements

  • Stomach interious can have a pH as low as 1 

    • Aids in food breakdown 

    • Kills most bacteria entering stomach

Carbon is a central element

• Carbon permeates the world of life 

• Life is based on carbon

  • Orgasims contain many different types of carbon compounds immersed in water 

  • Many other elements join carbon

• Outer shell of carbon has 4 electrons; can hold 8

• Each carbon atom can form covalent bond with up to 4 atoms

Organic chemistry

• The study of carbon-containing compounds

  • “Organic molecules” possess both carbon and hydrogen, and often atoms of other elements too

Methane

Simplest Organic (=carbon containing) Compound

Carbon Containing Compounds

• Only living organisms can produce these compounds

  • Carbohydrates 

    Lipids 

    Proteins

    Nucleic Acids

Carbohydrates

• Sugars, starch, and many other molecules

• Rich in many foods

• Organic molecules containing carbon (C), hydrogen (H), and oxygen (O)

  • Glucose = C₆H₁₂O₆

Monosaccharides

• Simplest carbohydrate sugars

  • Building blocks of carbohydrates

    • Ex. Glucose, fructose, deoxyribose, etc.

  • Most are sweet tasting, water soluble

  • Most have 5- or 6-carbon backbone

Disaccharides

• Formed by covalently joined monosaccharides

  • Ex. Glucose + fructose = Sucrose

    • “Table sugar”

  • Ex. Lactose

    • “Milk sugar”

Polysaccharides

• Sugar chains

  • Formed by large numbers of covalently joined monosaccharides

  • Many different forms

    • “Complex Carbohydrates”

Complex Carbohydrates

• Cellulose

• Lipids

• Proteins

• Nucleic Acids

Lipids

• Doesn’t dissolve easily in water 

  • Fats

  • Phospholipids

  • Waxes

• Composed of C + H

  • Carbon backbone

• Often has small amounts of O

Roles of Lipids

• Cell compartmentalization

  • forms cell membranes

• Energy storage

• Insulation

• Some hormones

Formation of typical plant cell

• has cell wall + cell membrane

  • cell membrane also called plasma membrane

Cell membrane

• found inside cell wall of plant

• made of phospholipids

Fluid mosaic

Phospholipids form cell membrane w/ proteins; aren’t bound together

Phospholipid structure

Has a hydrophilic head and two hydrophobic tails

Saturated fats

• Hydrogenation - conversion of oils into fats by saturation

  • Done by bubbling hydrogen through naturally occurring oils

  • Foods w/ hydrogenated oils - creamy, not oily

  • Shelf life enhanced

  • Downside - unhealthy + can cause heart disease

    • Raise levels of molecules carrying cholesterol to heart

      • “Bad” cholesterol

    • Lower levels of molecules carrying cholesterol away from heart

      • “Good” cholesterol

Steroid lipids

• Another class of lipids

• Central element - 4 carbon ring structure

• Many diff. types

  • EX. cholesterol, estrogen, testosterone

Steroid hormornes

• Estrogen + testosterone

  • Main female + male steroids

  • Regulates reproduction + other processes

• Pharmaceutical steroids

  • Artificial muscle-building hormones

Proteins

• Made up of sequence of amino acids

• Comprise ~half of dry weight of most cells

  • Dry weight doesn’t include water

• Very numerous + diverse

  • Many different roles

    • EX. enzymes - catalyzes chemical reactions

All proteins in organisms are assembled from…

• only 20 different amino acids

  • These amino acids are strung together in different orders +  different lengths to make different proteins

Protein function’s shape is…

• Critical

  • Held together by chemical bonds

    • Covalent, ionic, hydrogen bonds

• Can come undone

  • Protein “denaturation”

  • EX. Change in pH can change protein

  • EX. Alcohol can denature proteins

One wrong amino acid

• Single amino acid change in chain of amino acids can cause sickle cell anemia

Sickle cell anemia

• Low oxygen causes red blood cells to clump

• Clumping prevents normal blood flow

• Can damage tissues + organs throughout body over time

Nucleic Acids

• Polymers (composed of) of nucleotides

  • Made up of sugar, a phosphate group, + nitrogen-containing base

• DNA

• RNA

DNA

• Deoxyribonucleic acid - genetic material of all living organisms

  • Two intertwined polymers of nucleotides

    • “Double helix”

  • Contains info for production of proteins

  • Sugar-phosphate backbone

  • Covalent bonds of 4 nucleotides to backbone (A, T, C, G)

  • H bonds between bases

One side of DNA sequence

AGCTCGATGTCAATCT

In a DNA molecule…

• A pairs w/ T

• G pairs w/ C

RNA

• Ribonucleic acid - similar structure of DNA

• Takes information from DNA + catalyzes amino acids into proteins (translation + transcription)

• Usually single strands

• 4 types of nucleotides (sequence)

Unlike DNA, RNA has what instead of T?

Uracil (U)

RNA sequence

AUGCACACCUGAGAUCGACUAG

C is…

cytosine

G is…

guanine

A is…

adenosine

T is…

thymine