biochemisty review

What is biochemistry?

The study of chemical processes within living organisms.

What are organic compounds?

Compounds that contain carbon, making life on earth 'carbon-based'.

What are biomolecules?

Molecules found in living organisms, including carbohydrates, lipids, proteins, and nucleic acids.

What are the main functions of carbohydrates?

To provide and store energy and to provide structure and support to many organisms.

What are monosaccharides?

The basic unit of carbohydrates, examples include glucose, fructose, and ribose.

What are disaccharides?

Carbohydrates formed from two monosaccharide units, examples include sucrose, maltose, and lactose.

What are polysaccharides?

Molecules formed by long chains of monosaccharide units, examples include starch, glycogen, cellulose, and chitin.

What are lipids?

Compounds with a basic fatty acid-glycerol structure, relatively insoluble in water, and soluble in nonpolar solvents.

What are the functions of lipids?

To store energy, serve as structural components of membranes, provide insulation, and act as components of hormones and vitamins.

What are fatty acids?

The simple units of lipids, usually bound together by glycerol.

What distinguishes fats from oils?

Fats are solid at room temperature and typically obtained from animal sources, while oils are liquid at room temperature and usually obtained from plant sources.

What are proteins?

Long chains of amino acids that function for support, storage, transport, movement, and as enzymes.

What is a polypeptide?

A long chain of amino acids bonded by peptide bonds.

What are enzymes?

Biological catalysts that are usually proteins, initiating, speeding up, or inhibiting specific metabolic processes.

What are nucleic acids?

Molecules made up of nucleotides, which consist of nitrogenous bases and a sugar-phosphate backbone.

What are the two types of nucleic acids?

DNA (Deoxyribonucleic acid) and RNA (Ribonucleic acid).

What is the structure of DNA?

A double-stranded nucleic acid that carries genetic instructions, composed of A, T, C, and G.

What is base pairing in DNA?

A pairs with T and C pairs with G through hydrogen bonding.

What is the complementary strand of the DNA sequence 5' − ATGACTTACGGCTATAGATAG − 3'?

3' − TACTGAATGCCGATATCTATC − 5' or 5' − CTATCTATAGCCGTAAGTCAT − 3'.

What is RNA?

A single-stranded nucleic acid involved in the conversion of genetic information, composed of A, U, C, and G.

What is the Central Dogma of Molecular Biology?

The flow of genetic information summarized as DNA → mRNA → proteins.

What is DNA replication?

The synthesis of new DNA, occurring in the nucleus, involving a semi-conservative process.

What role does DNA helicase play in DNA replication?

It unwinds the parent DNA into two strands at the replication fork.

What is transcription?

The process of copying a segment of DNA to mRNA.

What is the role of RNA polymerase in transcription?

It adds matching RNA nucleotides paired with complementary DNA nucleotides in the 5' to 3' direction.