Bio 102 Lab Exam 2

UMKC

Once mitosis is complete, the two new daughter cells EACH have

Once mitosis is complete, the two new daughter cells EACH have

The same number of chromosomes as the parent cell and each other

how many daughter cells are created after mitosis and cytokinesis are complete?

2

What phase is this image?

Telophase

What phase is this image?

Metaphase

What phase is this image?

Anaphase

What phase is this image?

Prophase

During the typical cell cycle, does the DNA replicate during interphase or mitosis?

Interphase

Why is it critical that gametes are haploid cells and not diploid cells?

during fertilization, the fusion of two haploid gametes results in a diploid zygote with the correct number of chromosomes. If gametes were diploid, the resulting zygote would have double the number of chromosomes, leading to developmental abnormalities and potential infertility.

What are homologous chromosomes?

Homologous chromosomes are a pair of chromosomes that contain the same genes in the same order but may have different versions of those genes. One homologous chromosome is inherited from the mother and the other from the father. They are similar in size, and shape, and carry genetic information for the same traits.

What phase of meiosis is this image?

Anaphase II

What phase of meiosis is this image?

Metaphase I

What phase of meiosis is this image?

Telophase II

What phase of meiosis is this image?

Prophase I

How many daughter cells are created after meiosis and cytokinesis are complete?

4

If you begin with a parent cell that has 12 chromosomes, how many chromosomes will each of the daughter cells have after meiosis and cytokinesis are complete? Will these daughter cells be diploid or haploid cells?

6, haploid

Is this cell undergoing mitosis or meiosis?

Meiosis

How do you know which type of cell division is occurring in the image?

The DNA is being exchanged by the cell to the chromosomes.

When does crossing-over (exchange of DNA) in homologous pairs occur?

Prophase I of MEiosis

These are the daughter cells that have been produced after meiosis and cytokinesis are complete. How many total chromosomes did the parent cell have?

6

Does the “crossing over” of genetic information during meiosis occur in sister chromatids or non-sister chromatids?

non-sister chromatids

If an allele is expressed only when the dominant allele is NOT present, it is called the (BLANK) allele

recessive

According to the exercises we performed in lab, a corn plant that produces all yellow corn kernels can have which of the following genotype(s)?

Homozygous recessive (pp)

The classic Mendelian phenotypic ratio that results from a cross of two heterozygous parents (Pp x Pp) is

3:1

You have a corn plant that grew from a purple kernel. BOTH of its parents were homozygous dominant for purple kernels. Knowing that, what is your plant’s GENOTYPE (ANSWER 1). When your plant produces gametes, what allele will the gametes have for kernel color? (ANSWER 2)

PP, dominant

An individual with a heterozygous genotype for a given trait will express which of the two alleles it inherited? In other words, it’s phenotype will be (BLANK)

dominant

What is the “Central Dogma” of biology?

The Central Dogma of Biology is the fundamental principle that explains how genetic information flows within a biological system. It states that DNA is transcribed into RNA, which is then translated into proteins. This principle is essential to understanding the molecular basis of life.

In a DNA molecule, the “backbone” is comprised of a (BLANK) group and a (BLANK) molecule, which is bonded to one of the following four nitrogenous bases (BLANK), (BLANK), (BLANK), (BLANK), or (BLANK)

Phosphate, deoxyribose, adenine, thymine, guanine, cytosine

When DNA is replicated nucleotides are added in the (BLANK)’ to (BLANK)’ direction

5, 3

REPLICATE the following nucleotide sequence: 5’-ATGTCTCACGGGAATATGAAATGA3’

3'-TACAGAGTGCCCTTATACATTTACT-5'

What kind of molecule is the above nucleotide sequence?

DNA (deoxyribose nucleic acid)

TRANSCRIBE the nucleotide sequence: ATGTCTCACGGGAATATGAAATGA

AUGUCUCACGGGAAUAUGAAAUGA

Show the CODONS of your transcribed sequence “AUGUCUCACGGGAAUAUGAAAUGA”

AUG-UCU-CAC-GGG-AAU-AUG-AAA-UGA

TRANSLATE the nucleotide sequence from “AUG-UCU-CAC-GGG-AAU-AUG-AAA-UGA”

M/START-S-H-G-A-M-L-Stop

What kind of organic molecule is the sequence in your answer to: M/START-S-H-G-A-M-L-Stop

protein

Where does DNA replication occur?

Inside the nucleus

Where does Transcription occur?

Inside the nucleus

Where does Translation occure?

Outside the nucleus