Microbiology Exam 2

chapter 6,7,&8

All cells need to accomplish two fundamental tasks?

1. synthesize components for growth

2. produce/convert energy for biochemical reactions

metabolism

sum total of all chemical reactions in a cell 

what is the product of translation?

protein 

what is the product of transcription?

RNA

 If an mRNA codon reads 5' UAC 3', its complementary anticodon will be (read 5' to 3')

GUA

The building blocks of DNA are callled?

Nucleotides

 For the mRNA shown, at which codon will translation likely begin?

5′ GCCGGAAUGCUGCUGGC 3'

AUG

 To turn genes off, a regulatory protein called a(n) __________ is bound to the operator site so that

RNA polymerase is blocked from transcribing further

Repressor

 RNA Polymerase transcribes which strand of DNA?

 1.Template strand

2. Antisense strand

 The 3' end of DNA?

 1.refers to the end that has a hydroxyl group attached to the number 3 carbon of deoxyribose.

2. attaches to the 5' phosphate group of the incoming nucleotide.

 If 18% of nucleotides in an organism's DNA are guanine (G). What is the percent represented by

thymine (T)?

32%

 The scientist(s) that located the gene on the chromosome was?

 Thomas Hunt Morgan

 The lac operon is NOT transcribed in the presence of glucose because?

 The CAP protein does not bind to the CAP DNA binding site.

 The lac repressor is a(n)?

protein molecule

 The term antiparallel

 refers to the opposite orientation of the two strands in DNA.

 Repair mechanism that occurs during DNA synthesis is?

 proofreading by DNA Polymerase.

 An F pilus is essential for?

 plasmid transfer by conjugation.

 A culture of E. coli is irradiated with ultraviolet (UV) light. The UV light specifically

 forms covalent bonds between thymine nucleotides (thymine dimers) on the same strand of

DNA

 Segments of DNA capable of moving from one area of the DNA molecule to another are called?

transposons

 A silent DNA mutation?

 has no effect on the activity of the coded protein

X-rays

cause single and double strand breaks in DNA molecules.

 Repair mechanism that occurs after DNA replication is?

 1.mismatch repair

2. light repair 

3. SOS repair 

 Antibiotic resistance genes are commonly found on?

Plasmids

 The genetic makeup that controls specific characteristics of an organism is its?

Genotype

 What enzyme is responsible for adding methyl (CH3) groups to newly synthesized strands of DNA?

 DAM methylase

 Intercalating agents like Ethidium Bromide mutate DNA by?

 inserting in between base pairs of a strand of DNA.

 All proteins are coded for by genes but not all genes code for proteins.

True

 In eukaryotes transcription and translation are occurring simultaneously.

False

 Transposons were first discovered by Barbara McClintock through her work with corn.

True

 Each strand of the DNA double helix is identical to the other.

False

 In both prokaryotes and eukaryotes, the ribosome is composed of a small and a large subunit.

True

 Galactose binds the lac repressor and inhibits transcription of the lac operon.

False

 Organisms termed his- are considered prototrophic for histidine.

False

 During E. coli conjugation the F plasmid moves from the F+ bacteria to the F- bacteria without

replication.

False

 A deletion of one nucleotide within a gene, results in a frame shift mutation.

True

 Environment causes and selects mutants that grow under its conditions.

False

After two weeks of taking fecal samples of 50 piglets, what did the piglets do as soon as Pete

entered their pen?

The piglets defecated.

 Describe mismatch repair in E. coli. How does the system recognize the correct base. What enzymes are

involved.

 A gene has the following DNA sequence (coding strand is shown):

5' 3'

GGGCTATATGTCTGACGAGCTTCTATATGGGAGAAAGCCAGTATTCTCGCTTATCGTGTAATCCTC

What is the sequence of the mRNA?

5' GGGCUAUAUG UCU GAC GAG CUU CUA UAU GGG AGA AAG CCA GUA UUC

UCG CUU AUC GUG UAAUCCUC 3'

What is the amino acid sequence of the protein (use the codon table below)?

met ser asp glu leu leu tyr gly arg lys pro val phe ser leu ile val

Assuming that each amino acid has a molecular weight (MW) of 120, what is the MW of the

protein.

120 x 17 = 2040 MW

 Draw the lac operon. Label the promoter, operator and structural genes; give the enzyme name for

each of the genes.

 Describe the function of DNA Polymerase I, II and III. What cellular process are they involved in; what

functions are similar to both; what functions are different; which is considered the 'true' or necessary DNA

Polymerase? One to two sentences for each Polymerase is enough.

DNA Polymerase I - adds complementary nucleotides to the growing DNA strand during DNA

replication primarily on the lagging strand. It removes the RNA primer and replaces it with DNA. It

has proofreading activity.

DNA Polymerase II - It's primary functions is to fill in the gap created by enzymes during

Mismatch Repair.

DNA Polymerase III - adds complementary nucleotides to the growing DNA strand in the 5' to 3'

direction during DNA replication. It cannot start DNA synthesis de novo and cannot remove the

RNA primer. It has proofreading activity. This is the main and necessary ('true') DNA Polymerase.

 Start with the codon - CAG - using the codon table below, illustrate a silent, missense, and

nonsense mutation. Show the mRNA sequence and codon, including the wild type mRNA sequence

and codon. Which mutation is most likely to lead to a null mutation?

A nonsense mutation in most cases leads to a non-functional, truncated protein or no protein at all

and therefore is most likely to lead to a null mutation.

 What is the function of the bacterial sigma factor. Give one example of how either E. coli or B.

subtilis uses sigma.

The sigma factor is a protein that loosely binds to the RNA Polymerase and allows RNA

Polymerase to recognize specific classes of promoters, thereby controlling a set of specific genes. E.

coli will use σ70 for normal/healthy growth conditions and will switch to σ32 under heat shock

conditions. B. subtilis with use σA for normal/healthy growth conditions and then will switch to σE

and σK under stress conditions to transcribe genes needed for sporulation

catabolism

1. breaks down of compounds to release energy- large molecules are broken down into smaller molecules for energy to be released

2. cells capture energy to synthesize ATP

3. energy source is glucose

4. creates waste products ex. acids&carbon dioxide

5. Energy is released when breakdown occurs of compounds and ATP & uses it to make ATP

anabolism

1. biosynthetic process- small molecules are assembled into bigger ones, but energy is requires for this process

2. assemble subunits to make macromolecules 

3. uses ATP to drive reactions, processes intimately linked

4. creates nutrients ex. sulfur&source of nitrogen 

5. The processes use the ATP & precursor metabolites-glucose produced in catabolism 

Metabolic Pathways

Energy

Defined as the capacity to do work.

1. potential:stored energy (ex. chemical bonds, rock on hill, water behind dam)

2. kinetic: energy of movement (ex. moving water, vibration of molecules)

first law of thermodynamics 

1. the total amount of energy in the universe remains constant

2. energy can change from one state to another but it can never be created or destroyed 

second law of thermodynamics

1. the amount of disorder, or entropy-(is a measure of the disorder in a system), in the universe is increasing “entropy increases”

2. the increasing disorder means that energy is transforming from potential to heat (kinetic) energy

3. disorder is closed systems is continuously increasing ex. a clean to messy room

free energy

1. is energy available to do work.

2. energy is released when a chemical bond is broken

Exergonic- exothermic 

Reactants have more free energy (triangle G)than products, energy exits the system, energy is released during the reaction 

endergonic- endothermic

reactants have less free energy than products. reaction requires input energy to proceed.

couple reactions

within a cell - energy released from exergonic reactions power endergonic reactions

chemical reactions

spontaneous chemical reaction

very little activation energy is needed ex. sodium in air & sodium in water

chemical reaction

• food breaking down 

• lighting up wood

• fire releasing heat and light 

• products have less energy than the starting materials 

catalysis

• the process of lowering the activation energy- reaction occurs after

• catalyzed reactions proceed much faster than non catalyzed reactions

• a substance that lowers the activation energy is called a catalyst

• catalysts do not take a part in the reaction- they are not used up or changed

• the lower the activation energy, the easier it is for a chemical reaction to initiate

chemical reactions and catalysis

enzymes

• all enzymes are proteins, but not all proteins are enzymes

• are biochemical catalysts

• name ends in -ase

• have active sites to which substrates bind

biochemical catalysts

• speed up conversion of substrate into product by lowering activation energy

• highly specific for their reactants

• do not take part in the reaction

• reactions will occur without enzymes, but very slowly