LSU BIOL 2160

Which type of tissue us the least dense (has the fewest cells)?

a- muscle tissue

b- connective tissue

c- nervous tissue

d- epithelial tissue

connective tissue

homeostasis is the body's ability to maintain a ___ internal environment.

a- constant

b- stable

c- hostile

stable

In a positive feedback mechanism, the input and output are:

a- the same

b- Opposites

the same

sweating when you get hot is an example of what kind of feedback mechansim?

Negative

which type of gland utilizes a duct?

a- exocrine

b- endocrine

exocrine

insulin and glucagon are examples of __?

a- counterpoint activities

b- antagonist effectors

c- dynamic consistency

d- sensors and integrators

b- antagonist effectors

which part of a feedback mechanism is responsible for detecting the initial change?

a- integrating center

b- effector

c- sensor

sensor

adipose tissue (fat) is an example of what tissue type?

a- nervous

b -epithelial

c- muscle

d- connective

connective

what type of feedback system moves conditions further from the set point?

a- negative

b- positive

positive

which type of bond involves equal sharing of electrons?

a- polar

b- non polar

c- ionic

non polar

which atom is most likely to become an anion?

a- hydrogen (1 valence electron)

b- carbon (4 valence electrons)

c- sodium (1 valence electron)

d- chlorine (7 valence electrons)

chlorine

within the water molecule, which atom carries a partial negative charge?

a- oxygen

b- hydrogen

c- plutonium

oxygen

the bond within a single water molecule is an example of a __ bond.

a- hydrogen

b- polar covalent

c- non polar covalent

d- ionic

polar covalent

the bond between SEPARATE water molecules is an example of a ___ bond.

a- hydrogen

b- polar covalent

c- non polar covalent

d- ionic

hydrogen

is glycogen polar or non polar

polar

which type of fat will only have C-H bonds? saturated or unsaturated

saturated

which of these codons codes for an amino acid?

a- UAA

b- UGA

c- AUG

d- UAG

AUG

where are anti-codons found?

a- mRNA

b- tRNA

c- rRNA

tRNA

which site on the ribosome will receive the tRNA with the next amino acid to be added?

A or P site

A site

which level of protein structure refers to the overall 3-D shape of a protein?

a- primary

b- secondary

c- tertiary

d- quaternary

tertiary

an mRNA composed of 24 codons will code for a protein composed of ___ amino acids (stop codon)

a- 48

b- 24

c- 12

d- 23

23

what percent of our DNA actually codes for proteins?

a- 98%

b- 5%

c- 50%

d- 1.5%

1.5%

affinity between an enzyme and a substrate will have an effect at (LOW or HIGH) substrate concentrations

LOW

a reaction in which products have less energy than reactants is an ___ reaction?

a- endergonic

b- exergonic

exergonic

Where does glycolysis take place?

a- mitochondrial matrix

b- cytoplasm

c- nucleus

cytoplasm

which is the only stage of cellular respiration that does not directly produce ATP?

a- glycolysis

b- linking step

c- oxidative phosphorylation

d- lactic acid fermention

linking step

how many ATPs are made from 2 turns of the Krebs cycle?

a- 1

b- 2

c- 4

d- 10

2

what percentage of the total ATP produced is made during the first 3 stages of cellular respiration?

a- 10%

b- 20%

c- 25%

d- 50%

10%

what is the purpose of lactic acid fermentation?

a- produce lactic acid

b- produce ATP directly

c- produce NAD+

produce NAD+

movement of H+ into the ___ requires energy

a- intermembrane space

b- mitochondrial matrix

c-

intermembrane space

Physiology is to anatomy as:

Function is to structure

Which tissue type is specialized for sending and receiving

information?

nervous

Upon examining an unknown tissue specimen, you discover

that the tissue has very few cells and consists mostly of

extracellular material. This tissue type is most likely:

connective

Measuring thyroxine levels in the blood is an indicator of

thyroid gland activity. The thyroid gland is an example of

_____ gland

endocrine

Which of the following is an example of a positive feedback

mechanism?

Oxytocin causes uterine contractions, which results in

oxytocin being released

The molecule N-C contains which type of bond?

Nonpolar covalent bond

Why is water such a polar molecule?

Because electrons are more attracted to the nucleus of

oxygen than they are to the nucleus of hydrogen

Addition of which of the following functional groups to a

molecule will result in the greatest increase in its solubility in

water?

hydroxyl

If you were given a particular monosaccharide, and counted 10

hydrogen atoms in it, how many carbon atoms would be

present?

5

What makes phospholipids different than most other lipids?

They have both polar and nonpolar regions

Changing the amino acid sequence of a protein has a direct effect on which level of protein structure?

primary

Translation is the process of converting the language of ____ to the language of proteins

Nucleotides, amino acids

Where would you expect to find amino acids with polar

sidechains on a cytosolic protein?

on the outside

Within a particular DNA molecule, you discover that 20% of the bases are Adenine. What percentage is Guanine?

30%

Following transcription, the poly-A portion of the pre-mRNA transcript will be at which end?

3' end

anticodons are located on which molecule

tRNA

If the Rough Endoplasmic Reticulum were to become

damaged in a particular cell, which of the following processes would be MOST affected?

protein synthesis

The rRNA needed to make ribosomes comes from:

nucleolus

Which organelle's primary function is packaging and sorting

proteins?

Golgi apparatus

Which enzyme is responsible for adding complementary

ribonucleotides during transcription?

Polymerase

When an mRNA transcript binds to a ribosome, the mRNA is

composed of:

Exons

A protein that is 30 amino acids long will most likely be

coded for by a transcript that is _____ nucleotides long. (Not

counting the STOP codon)

90

The following transcript will code for a protein that is _____

amino acids long: AGAGGGCCUUAGAUGCCCGACGCAUGACCCGCGUG

ACCG

4

During translation, which site on the ribosome contains a

tRNA with several amino acids attached to it?

P site

A chemical reaction in which the products have more energy

than the reactants would be _____

Endergonic

Glycolysis is an example of ______ reaction

catabolic

How do enzymes speed up biological reactions?

By lowering activation energy

Enzymes with different affinities for substrates will have the

same reaction rate at:

Very high substrate concentrations

A _____ adds a phosphate group to an enzyme, and turns it

_____

Kinase, ON

Which of the following is FALSE about glycolysis?

it required oxygen

Which of the following processes results in an increase in

glycogen levels?

glycogenesis

Which molecule physically enters the Kreb's Cycle?

Acetyl coA

How many turns on the Kreb's cycle are needed to

completely break down one molecule of glucose?

2

How many molecules of ATP are produced from one

molecule of glucose that undergoes glycolysis, the linking

step, and 2 turns of the Kreb's cycle?

4

Of the total ATP produced during cellular respiration, what

percentage is generated by the electron transport chain?

90%

During chemiosmosis, where do protons get pumped?

into the intermembrane space

the theoretical ATP yield for one molecule of glucose that

completely undergoes cellular respiration is:

36

What is the purpose of fermentation?

Regenerate NAD+ for glycolysis

What is the purpose of oxygen during cellular respiration?

It receives electrons at the end of the electron transport

chain

Which of the following is a common exergonic reaction that

is coupled to many endergonic reactions in the cell?

glycogenesis

Pre-mRNA transcripts contain ______, while mRNA

transcripts do not.

introns

Melting/denaturing enzymes will destroy its ______ structure

tertiary

Glycogenesis is an example of an ______ reaction.

endergonic

Where does glycolysis occur?

cytoplasm

Which of the following molecules will contain a sugar with

an oxygen present in the 2' position?

RNA

As electrons are transferred down the electron transport

chain, potential energy is:

released

Which of the following is NOT a stop codon?

UUA

If phosphates were to stop functioning in a cell, what would

be the immediate consequence?

Proteins would remain in the ON position too long

What gets produced during the linking step of cellular

respiration?

2 Acetyl coAs