Molecular Biology and Transcription

A set of vocabulary flashcards covering key concepts related to molecular biology and transcription.

Hershey-Chase Experiment

Demonstrated that DNA, not protein, is the genetic material that is injected into host cells.

Radioisotope $^{32}$P

Labels nucleic acids like RNA and DNA but not proteins.

Central Dogma of Molecular Biology

Describes the flow of genetic information from DNA to RNA to protein.

DNA Alphabet

Composed of four letters: A (Adenine), T (Thymine), C (Cytosine), G (Guanine).

RNA Alphabet

Composed of four letters: A (Adenine), U (Uracil), C (Cytosine), G (Guanine).

Protein Alphabet

Consists of 20 letters corresponding to the number of common amino acids.

Upstream

Region of DNA before the start of transcription, containing regulatory elements.

Downstream

Region of a gene located within or after the transcribed sequence.

Enhancer

A DNA sequence that binds an activator protein to increase the rate of transcription.

Silencer

A DNA sequence that binds a repressor protein to decrease or prevent transcription.

Promoter

The DNA region where RNA polymerase binds to initiate transcription.

Open Reading Frame (ORF)

Segment of a gene that is transcribed into RNA and codes for a protein sequence.

Introns

Non-coding sequences within a eukaryotic gene that are removed from pre-mRNA during processing.

Exons

Coding sequences of a eukaryotic gene that are joined together to form mature mRNA.

Activator Protein

Binds to enhancer DNA to promote transcription.

Repressor Protein

Binds to silencer DNA to prevent transcription.

Transcription Factors

Proteins that bind to specific DNA sequences to control transcription.

Template Strand

The DNA strand read by RNA polymerase during transcription.

Coding Strand

The DNA strand not used as a template during transcription but similar to the resulting RNA.

Steps of Transcription

The four main steps are Template Recognition, Initiation, Elongation, Termination.

Holoenzyme

The complete RNA polymerase enzyme consisting of the core enzyme and the sigma factor.

Sigma Factor

Recognizes the promoter sequence and brings the core RNA polymerase to the correct start site.

Closed Promoter Complex

Initial complex formed when RNA polymerase fully binds to the double-stranded promoter DNA.

Open Promoter Complex

Formed when the duplex DNA unwinds at the -10 region during transcription initiation.

Transcription Bubble

Localized region of unwound DNA where RNA synthesis occurs during elongation.

RNA Synthesis Rate

Approximately 20-50 nucleotides per second during the elongation phase of transcription.

Termination of Transcription

RNA synthesis ends, and the newly made RNA molecule falls off the DNA template.

Splicing

The process of removing introns and joining exons from a pre-mRNA molecule.

5' Cap

A structure added to the 5' end of a eukaryotic pre-mRNA during processing.

Poly-A Tail

A long chain of adenine nucleotides added to the 3' end of a eukaryotic pre-mRNA during processing.

Coding Region

The region of a mature mRNA molecule that is actually translated into protein.

Post-Transcriptional Modification

Changes made to the RNA molecule after transcription, including capping and splicing.

snRNPs

Complexes of small nuclear RNA (snRNA) and proteins crucial for splicing.

5' Splice Site Sequence

GU; a conserved two-base sequence typically found at the 5' splice site of an intron.

3' Splice Site Sequence

AG; a conserved two-base sequence typically found at the 3' splice site of an intron.

Lariat Structure

Formed during splicing via an unusual 5'-2' phosphodiester bond involving a branch point adenine nucleotide.

Alternative Splicing

A process where different combinations of exons are joined together to produce different mRNAs.

DNA and RNA Synthesis Direction

All DNA and RNA synthesis is carried out in the 5' to 3' direction.

Semi-Discontinuous Replication

Describes DNA replication where the leading strand is synthesized continuously, and the lagging strand is in fragments.

Leading Strand

The DNA strand synthesized continuously during replication.

Lagging Strand

The DNA strand synthesized in short, discontinuous pieces during replication.

Okazaki Fragments

Short fragments of DNA synthesized on the lagging strand.

DNA Template Sequence

If 3' - TACAATTCATAAAGCCACGTAATC – 5', the resulting mRNA would be 5’- AUGUUAAGUAUUUCGGUGCAUUAG-3’.

Mature mRNA Sequence

If the non-template strand is 3’ - TACAATTCATAAAGCCACGTAATC – 5’, the resulting mRNA is 5’ – CUAAUGCACCGAAAUACUUAACAU-3’.

Hydrogen Bonds in DNA Base Pairing

Form between a carbonyl group (C=O) and an amino group (NH2).

Hydrogen Bonds in Base Pairing

Form between an imino group (NH) and a ring nitrogen (N).

Control Regions of a Gene

Contains binding sites for multiple sequence-specific DNA binding proteins (transcription factors).

5' Untranslated Region (5' UTR)

Portion of the mature mRNA molecule that is upstream of the start codon and is not translated.

3' Untranslated Region (3' UTR)

Portion of the mature mRNA molecule that is downstream of the stop codon and is not translated.

Pre-mRNA

The initial, unprocessed RNA molecule produced from transcription.