bio 111 (exam 3)

How would you describe the composition of DNA monomers?

All of the monomers contain a phosphate group and a nitrogenous base connected to deoxyribose.

The secondary structure of a double-stranded DNA helix molecule can best be described as a _____.

sugar-phosphate backbone with the bases of the complementary base pairs adenine-thymine and guanine-cytosine projecting toward the inside of the backbone

How does DNA polymerase add dNTP (deoxyribonucleotide triphosphate) monomers to the growing chain?

The 3' carbon of the DNA chain forms a covalent linkage with the phosphate group on the 5' end of the dNTP.

Which complementary strand would be synthesized from the following portion of a DNA molecule? 3' AACCGTAATTCG 5'

5' TTGGCATTAAGC 3'

How is DNA synthized

Semiconservative Replication

DNA replication is semiconservative because replicated DNA molecules are composed of

one strand of old DNA and one strand of new DNA

The following DNA sequence 3'AATTGCAGATTCA 5' occurs at a DNA origin of replication. What sequence would bind to this DNA sequence as a primer to initiate replication?

5' UUAACGUCUAAGU 3'

Cytosine makes up 42% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be thymine?

 8%

DNA polymerase cannot replicate DNA unless an RNA primer is first attached to the template strand. This is because DNA polymerase can only _____

add onto existing 3′ hydroxyl groups

Researchers design experiments so that only one thing is different between the treatments that are being compared. In the Hershey minus−Chase experiment, what was this single difference?

Labeling either DNA or proteins

In the classic experiments carried out by Hershey and Chase, the coat of the T2 virus consisted of what kind of macromolecules?

Protien

The enzyme that synthesizes RNA primers for use in DNA replication is

primase

A mutation that knocked out the proofreading function of DNA polymerase would result in

a higher-than-normal rate of DNA synthesis errors

Predict how the mutation rate associated with DNA synthesis would be affected if the system that distinguishes the parental and daughter DNA strands in mismatch repair were defective.

The mutation rate would increase because there would be no way to distinguish the strand with the error and the strand to use as a template in correcting this error.

What aspect of DNA structure makes it possible for the proteins of nucleotide excision repair to recognize many different types of DNA damage?

The regularity of DNA's structure

How are Okazaki fragments synthesized?

by using the lagging-strand template, and synthesizing 5’ → 3 '

RNA primers required for polymerase to continue synthesis must be present on which strand during DNA synthesis?

Both leading and lagging strands

Telomerase synthesizes DNA in the __direction.

5’ to 3’ direction.

Why is the enzyme telomerase important in some cells?

Telomerase extends the unreplicated ends of linear chromosomes.

Which of these steps happens first when telomerase prevents linear chromosomes from shortening during replication?

Using its RNA template as a guide, it catalyzes the addition of deoxyribonucleotides to the overhang.

Which enzyme is responsible for unwinding the DNA double helix during replication?

Helicase

What is the role of DNA polymerase in DNA replication?

Adds nucleotides to the growing DNA strand

Which enzyme synthesizes short RNA primers needed to start DNA replication?

Primase

The enzyme that joins Okazaki fragments on the lagging strand is:

DNA ligase

What is the function of topoisomerase in DNA replication?

Preventing the DNA ahead of the replication fork from supercoiling

Which of the following statements is true of DNA synthesis?

DNA polymerase requires a single-stranded template in addition to the short complementary RNA primer in order to synthesize DNA.

What would happen if you added telomerase to cell cultures

• Allows them to continue to divide

• Cancer usually has active telomerase

• Allows unlimited cell division

Benzopyrene in cigarette smoke binds to DNA and distorts its shape, interfering with DNA replication. Which repair mechanism would most likely be used to repair the damage caused by this chemical?

nucleotide excision repair

Beadle and Tatum proposed the one-gene, one-enzyme hypothesis based on

N. crassa knockout mutants that lacked the ability to synthesize certain compounds when the enzyme needed was mutated

DNA → ________ → Proteins

mRNA

rRNA

ribosomes

tRNA

translations

RNA POLYMERASE

Synthesized RNA
Uses DNA strand as template
Uses complementary nucleotides

Not a property for genetic code

It is overlapping

The start codon in most organisms is

AUG

What is the primary function of a gene?

To carry the instructions for making proteins

Genes are segments of

DNA

What change in the nature of the genetic code could be possible if, instead of two sets of base pairs (A-T, G-C), there were three sets of base pairs (A-T, G-C, X-Y)?

The extra base pair would make it possible to have codons two bases in length rather than three.

HOW MANY BASES IN A “W0RD”?

three base code = 4×4 = 64

The genetic code is essentially the same for all organisms.

A gene from an organism can theoretically be expressed by any other organism.

Mutation

any permanent change in DNA

Missense mutations

change an amino acid in protein

Silent mutations

do not change amino acid sequence due to redundancy in the code

Frameshift mutations

shift reading frame, altering meaning of all subsequent codons

Nonsense mutations

change codon that specifies an amino acid into stop codon

An original section of DNA has the base sequence AGCGTTACCGT. A mutation in this DNA strand results in the base sequence AGGCGTTACCGT. What type of mutation does this change represent?

frameshift mutation

point mutation

change 1 letter

missense mutation

change amino acid

what DNA mutations is most likely to damage the protein it specifies?

a base-pair deletion

Which type of mutation causes a premature termination of protein synthesis?

nonsense

Inversion

segment of chromosome breaks off, flips around, and rejoins

Translocation

section of chromosome breaks off and becomes attached to another chromosome

Deletion

segment of a chromosome is lost

Duplication

segment of chromosome is present in multiple copies

Bacteria

one RNA Polymerase

Eukaryotes

at least three RNA Polymerase

what processes occurs in prokaryotes but not in eukaryotes?

transcription and translation occur simultaneously

How can a point mutation affect the protein produced?

It may change one amino acid or have no effect at all

Mutation

A change in the DNA sequence

A “silent mutation” is a type of mutation that:

Has no effect on the amino acid sequence

What is a frameshift mutation?

A mutation caused by the insertion or deletion of a nucleotide, changing the reading frame

How does the primary transcript in the nucleus of a eukaryotic cell compare to the functional mRNA?

the primary transcript is larger than the mRNA

molcules needed for translation

the primary transcript is larger than the mRNA

tRNA

“Transfer”

3 Parts of RNA Processing

• Splicing

• 5’ cap

• 3’ poly A tail

Which of the following molecular structures contain codons?

mRNA

Which of the following molecular structures contain anticodons?

tRNA

A particular triplet of bases in the template strand of DNA is 5′-AGT-3′. What would be the corresponding codon for the mRNA that is transcribed?

3′-UCA-5′

The anticodon of a particular tRNA molecule is

complementary to the corresponding

mRNA codon

Wobble pairing

anticodon’s third position can form a nonstandard base pair

A site

(acceptor or aminoacyl), tRNA carries an amino acid

P site

(peptidy, holds growing peptide chain

E site (exit)

- tRNAs without amino acids exit the ribosome

What is the function of the release factor during translation in eukaryotes?

It binds to the stop codon in the A site in place of a tRNA

Which of the following processes occurs when termination of translation takes place?

A stop codon is reached.

Once a peptide bond has been formed between the amino acid attached to the tRNA in the P site and the amino acid associated with the tRNA in the A site, what process occurs next?

translocation

What is a metabolic pathway

A series of chemical reactions where enzymes work one at a time to convert a reactant into intermediates and the intermediates into a final product.

Predict what Crick and Brenner would have found if codons were two bases long.

They would have found that one-base-pair insertions or deletions would disrupt protein function because of changing the reading frame, but that adjacent two-base-pair insertions or deletions would not destroy protein function because the reading frame would be maintained.

What is the relationship between the nucleotide sequence of a gene and the amino acid sequence of a protein?

The nucleotide sequence of a gene is transcribed into a nucleotide sequence of mRNA, which is read during translation in groups of three nucleotides that specify each amino acid.

What type of mutation would be created by changing the codon-specifying sequence 5'-ATA-3' in the non-template strand of DNA to ATC?

Silent

Which of the following describes mutations?

Point mutations can occur in any DNA sequence.

A frameshift mutation that occurs in the DNA and results in an amino acid change near the beginning of a protein sequence would have what effect on the protein's structure?

Primary, secondary, and tertiary protein structures would be altered.

Which of the following describes the experimental strategy that was used to decipher the genetic code?

examining the polypeptides produced when RNAs with particular sequences were translated

What feature of the genetic code makes it possible for a single protein to be encoded by more than one mRNA sequence?

More than one codon can specify the same amino acid.

Predict how many different mRNA sequences could code for the following amino acid sequence plus a stop codon: Met-Trp-Cys-(Stop).

6

How many amino acids would be encoded in the sequence prime 5′AUGUUACGGAAUGCAAUGUUACGGAAUGCA prime3′ by a non-overlapping and a maximally overlapping triplet code?

5 (non overlapping) - 13 (overlapping)

What does a bacterial RNA polymerase produce when it transcribes a protein-coding gene?

mRNA

A promoter and a start codon are similar in that both are sequences of

nucleotides that signal the beginning of transcription

promoter is needed to start

transcription

start codon is needed to start

translation

promotor is a

DNA sequence only

start codon is only found in

mRNA

In order to initiate transcription in eukaryotes, ]

transcription factors bind to the promoter, and RNA polymerase is then recruited to begin transcribing the gene

Where is the start codon located?

At the downstream end of the 5' untranslated region (UTR)

Why is it important that the initiator tRNA be placed in the P site instead of the A site?

The A site must be empty to allow the next aminoacyl tRNA to come into the ribosome.

An aminoacyl-tRNA that enters the A site of the ribosome will next occupy which site?

P site

As a result of alternative splicing, most protein-coding genes can encode ______ protein.

more than one

In addition to splicing, additional modifications at the 5' and 3' end are required to generate a mature mRNA. What is the significance of these modifications?

These modifications allow the mRNA to be recognized by the protein synthesis machinery and protect it from degradation.

In a particular bacterial species, temperature-sensitive conditional mutations cause expression of a wild-type phenotype at one growth temperature and a mutant phenotype at another minus−typically higher minus−temperature. Imagine that when a bacterial cell carrying such a mutation is shifted from low to high growth temperatures, RNA polymerases in the process of elongation complete transcription normally, but no new transcripts can be started. The mutation in this strain most likely affects ___

sigma

Compared with mRNAs that have a cap and tail, predict what will be observed if an eukaryotic mRNA lacked a cap and poly(A) tail.

Translation would not initiate properly.