1/46
Looks like no tags are added yet.
Name | Mastery | Learn | Test | Matching | Spaced |
---|
No study sessions yet.
The building blocks of nucleic acids are known as
nucleotides
The acronym DNA stands for
deoxyribonucleic acid
DNA makes up chromosomes, which are located in the _________ of a cell
nucleus
Small sections of a DNA molecule that determine genetic traits are called
genes
The sugar found in DNA is
deoxyribose
The pyrimidine bases are _______ and _______
cytosine and thymine
The purine bases are ________ and _________
guanine and adenine
In complimentary base paring, ___ bonds with ____ and _____ bonds with _______
A, T and C, G
A DNA molecule consists of _______ strands
2
DNA is a long chain made of repeating units called
nucleotides
Nucleotides are attached by bonds between the ______ and the phosphate group
sugar
DNA is shaped like a ______ helix
double
What are the "sides" of the DNA ladder made of
sugar and phosphate
What are the "rungs" of the DNA ladder made of
bases
The replication of DNA begins with the _____ of the double helix
unzipping
DNA replication is said to be ______ because each strand acts as a template to contruct the other half of the molecule.
semi conservative
what is the function of DNA in cells
genetic code
Describe the components and structure of a DNA nucleotide
sugar, phosphate, base
List the names and abbreviations of the 4 bases
A- Adenine, T- Thymine, C - Cytosine, G - Guanine
Why is DNA called a double helix
because it is 2 strands in a helix
What forms the sides of DNA ladder
sugar & phosphate
What forms the rungs of the DNA ladder
bases
Where and in what form is eukaryotic DNA found
nucleus → chromosomes
What is meant by the term base-pairing? How is base-pairing involved in DNA replication
The bases across from each other H bond together, in replication base pairing says what base to add
Explain how DNA is replicated
1. unzip helix
2. add new nucleotides
3. re-zip new strands
The base sequence of the template strand of DNA is CTACGCTAGGCGATTGAACT What is the new Synthesized complementary strand
GATGCGATCCGCTAACTTGA
Why does DNA need to replicate
so the cell can divide
In relation to the pictures below. Explain three main steps in the process of DNA replication. Name the enzymes that go with each step
a. unzip
b.
c. add new nucleotide
In which direction are new nucleotides added during replication
5' ------> 3'
What is a leading and lagging strand
made all at once
What is a lagging strand
made in pieces
What do you think would happen if the process occurred incorrectly
messed up genes
Why does DNA replicate
so a cell can divide
Is DNA replication described as conservative or semi- conservative
semi - new DNA is half old and half new
What 2 enzymes are used during DNA replication? Describe what each does during replication
helicase - unzip
polymerase - add nucleotides
When does DNA replication occur in a cell
interphase
Where does DNA replication occur in a cell
nucleus
Cytosine, guanine, thymine and adenine are referred to as
bases
DNA is in the shape of a
helix
A nucleotide is made up of a
sugar, phosphate and one nitrogen base
Replication is performed prior to
cell division
Adenine always paris with
Thymine
Complementary base pairing matches up compelmentary
bases
The sides of the DNA molecule are made up of repeating
phosphates
The letters that make up the DNA molecule code for
genes
Replication results in two strands of DNA, each of which
half of the original strand
______ bonds hold nitrogen bases together, forming the rings of the DNA ladder
hydrogen