9th Grade Biology DNA

The building blocks of nucleic acids are known as

nucleotides

The acronym DNA stands for

deoxyribonucleic acid

DNA makes up chromosomes, which are located in the _________ of a cell

nucleus

Small sections of a DNA molecule that determine genetic traits are called

genes

The sugar found in DNA is

deoxyribose

The pyrimidine bases are _______ and _______

cytosine and thymine

The purine bases are ________ and _________

guanine and adenine

In complimentary base paring, ___ bonds with ____ and _____ bonds with _______

A, T and C, G

A DNA molecule consists of _______ strands

2

DNA is a long chain made of repeating units called

nucleotides

Nucleotides are attached by bonds between the ______ and the phosphate group

sugar

DNA is shaped like a ______ helix

double

What are the "sides" of the DNA ladder made of

sugar and phosphate

What are the "rungs" of the DNA ladder made of

bases

The replication of DNA begins with the _____ of the double helix

unzipping

DNA replication is said to be ______ because each strand acts as a template to contruct the other half of the molecule.

semi conservative

what is the function of DNA in cells

genetic code

Describe the components and structure of a DNA nucleotide

sugar, phosphate, base

List the names and abbreviations of the 4 bases

A- Adenine, T- Thymine, C - Cytosine, G - Guanine

Why is DNA called a double helix

because it is 2 strands in a helix

What forms the sides of DNA ladder

sugar & phosphate

What forms the rungs of the DNA ladder

bases

Where and in what form is eukaryotic DNA found

nucleus → chromosomes

What is meant by the term base-pairing? How is base-pairing involved in DNA replication

The bases across from each other H bond together, in replication base pairing says what base to add

Explain how DNA is replicated

1. unzip helix
2. add new nucleotides
3. re-zip new strands

The base sequence of the template strand of DNA is CTACGCTAGGCGATTGAACT What is the new Synthesized complementary strand

GATGCGATCCGCTAACTTGA

Why does DNA need to replicate

so the cell can divide

In relation to the pictures below. Explain three main steps in the process of DNA replication. Name the enzymes that go with each step

a. unzip
b.
c. add new nucleotide

In which direction are new nucleotides added during replication

5' ------> 3'

What is a leading and lagging strand

made all at once

What is a lagging strand

made in pieces

What do you think would happen if the process occurred incorrectly

messed up genes

Why does DNA replicate

so a cell can divide

Is DNA replication described as conservative or semi- conservative

semi - new DNA is half old and half new

What 2 enzymes are used during DNA replication? Describe what each does during replication

helicase - unzip
polymerase - add nucleotides

When does DNA replication occur in a cell

interphase

Where does DNA replication occur in a cell

nucleus

Cytosine, guanine, thymine and adenine are referred to as

bases

DNA is in the shape of a

helix

A nucleotide is made up of a

sugar, phosphate and one nitrogen base

Replication is performed prior to

cell division

Adenine always paris with

Thymine

Complementary base pairing matches up compelmentary

bases

The sides of the DNA molecule are made up of repeating

phosphates

The letters that make up the DNA molecule code for

genes

Replication results in two strands of DNA, each of which

half of the original strand

______ bonds hold nitrogen bases together, forming the rings of the DNA ladder

hydrogen