Chem 441A: Chapter 3 - Structure and Function of Nucleic Acids

Nucleotides

the building blocks of DNA and RNA

There are ___ bp of nucleotides in human DNA

6×10^9

Nucleotides consist of three components: ___

nitrogen base, pentose sugar, a phosphoryl group

Purines

• adenine (A) and guanine (G)

• have two heterocyclic rings

• found in both DNA and RNA

Pyrimidines

• cystone (C), thymine (T), and uracil (U)

• one ring

• thymine found only in DNA

• uracil found only in RNA

Key properties of nitrogenous bases

• planar, aromatic, and heterocyclic

• have C and N in the rings

• absorb UV light at 260 nm

Ribose found in ___

RNA

Deoxyribose found in ___

DNA

How many phosphate groups can be in a nucleotide?

one, two, or three

Phosphodiester bond

in DNA and RNA, only one phosphate group that links two nucleotides

Nucleotides found in DNA

• deoxyadenosine monophosphate (dAMP)

• deoxyguanosine monophosphate (dGMP)

• deoxythymidine monophosphate (dTMP)

• deoxycytidine monophosphate (dCMP)

Nucleotides found in RNA

• adenosine monophosphate (AMP)

• guanosine monophosphate (GMP)

• uridine monophosphate (UMP)

• cytidine monophosphate (CMP)

Primary DNA structure

unique sequence of nucleotides in polymer

Primary DNA is a ___

directional molecule

Primary DNA reads from ___ to ___

5’ end to 3’ end

Secondary DNA structure

is a J Watson & F Crick model

The Watson-Crick model of DNA

the polynucleotide chains wind around a common axis to form a double helix

The two strands of DNA are ___ and ___-handed helix

antiparallel (complementary), right

___ occupy the core of helix. Outside are ___ and ___ - both polar and prevent repel each other

nitrogenous bases, phosphate, ribose

___ pair is more abundant in thermophilic microorganisms. More energy is required to break the strands apart

GC

___ pair is more abundant in promoter region, TATA box. Easy to separate strands

AT

Watson strand

top or coding strand

Crick strand

bottom or template strand

Chargaff’s rule

• DNA has equal numbers of A and T, and equal numbers of G and C

• DNA base composition varies from species to species but remains constant among the related species

• No rule of RNA governing the nucleotide composition

A-DNA

• short and wide (23 A)

• right-handed

• dehydrated (cannot bind to water easily)

• bases - 11 bp/turn

B-DNA

• most stable

• right-handed

• hydrated

• bases - 10.5 bp/turn

Z-DNA

• most narrow (18 A)

• 12 bp/turn

• left-handed

• B-Z junction

• often found right before the gene sequence

B-Z junction

the site where the DNA molecule switches its chirality

Similarities between B and Z DNA

• a double helical structure

• based on a traditional Watson-Crick base pairing

Dissimilarities between B and Z DNA

• Z-DNA has a zig-zag shape and is left-handed

• Z-DNA exists transiently in short stretches of up to 100 bp within some right-handed DNA molecules

Nucleotides absorb light in the ___ range (260 nm)

UV

A and G have a higher ___ than T and C

molar extinction coefficient (εM)

Molar extinction coefficient (εM)

used to measure the concentration of DNA and RNA

1 AU at Abs260nm = ___

50 ug ds DNA/ml; 40 ug ss RNA/ml

UV light absorption order

nitrogen bases > nucleotides > single stranded DNA > double stranded DNA

Hyperchromic shift

the phenomenon of increasing UV absorbance as DNA is denatured

Melting temperature (Tm)

the temperature at which the DNA is half-denatured

Hyperchromic shift is used to determine ___

the melting temperature (Tm) of DNA

Higher the GC%, higher the ___

melting temperature

Longer the DNA, higher the ___

melting temperature

Higher the anionic strength, higher the __

melting temperature

Circular DNA (usually plasmids)

when the ends of DNA strands are joined to make a closed structure

Circular denotes ___ and not just the shape

a closed loop

A circular DNA can be ___ either positively or negatively twisted

supercoiled

Supercoiling

twisting of circular DNA in a positive or negative direction

+ supercoils

• left-handed

• positive supercoil

- supercoil

• right-handed

• negative supercoil

• under-wound

Most DNAs are ___ supercoiled

negatively

Linking number (Lk)

• a number of times one strand crosses the other in a Watson-Crick model of DNA

  • can be calculated by dividing the number of base pairs/10.5 base pairs (one turn or twist consists of 10.5 base pairs)

Twist

turn one DNA strand wraps another strand

Writhe

the number of times one duplex (double stranded DNA) crosses another duplex

Linking number for a circular DNA is the sum of ___

twists (Tw) and writhe (Wr): Lk = Tw + Wr

For δ = ∆Lk/Lk°, if δ is negative, the supercoiling is ___ and if positive then the supercoiling is ___

negative, positive

Topoisomerases

enzymes that change the topology of DNA

Type I topoisomerase

breaks one strand and crosses another strand and reseals

Type II topoisomerase

breaks both strands and crosses a duplex and reseals back

Type II topoisomerase serves as a candidate for anti-cancer drugs, because type II topoisomerases ___

• are essential for replication

• inhibition of these enzymes leads to cell death

RNA can be found in different forms

• messenger RNA (mRNA)

• transfer RNA (tRNA)

• ribosomal RNA (rRNA)

• and other regulatory RNA such as iRNA (snRNA, miRNA). They play a role in regulation of gene expression

tRNA modified bases are required for ___

stability, recognition of tRNA with amino acyl-tRNA synthetases during replication, high fidelity, and efficient translation. More than 80 modifications and at least 13 nucleotides are post-transcriptionally modified

DNA structural differences

• double stranded

• comprised of A, T, G, and C

• DNA stable

• DNA stores genetic information

• has deoxyribose sugar

RNA structural differences

• single stranded

• comprised of A, U, G, and C

• RNA unstable

• RNA translates genetic information into protein

• has ribose sugar

Histones

positively charge proteins due to rich in R, K, and H

Nucleosomes

histones wrapped by negatively charged DNA

Binding of histones is ___

non-specific

Binding of single-stranded binding proteins, such as repressor proteins, is ___

specific and recognize the sequence

Human genome project (HGP) - 2003

• whole genome was sequenced

• 23 pairs of chromosomes

• 3.0 billion base pairs

• ~30,000 genes (only ~8.5% of total bp)

• rest of DNA - junk DNA

DNA condensation process

DNA —> nucleosome —> chromatin —> looped chromatin —> condensed coils of chromatin —> chromosome

Chromatin

genomic DNA that has condensed using protein-DNA complexes

Euchromatin

• less dense

• susceptible to nuclease digestion

• undergoes modification

• coding sequences

Heterochromatin

• more dense

• protected from nuclease digestion

• do not undergo modifications

• noncoding sequences

Histone modifications

• methylation

• acetylation

• phosphorylation

Genes

• structural units of chromosomes

• consist of upstream regulatory DNA sequences (promoter region) and downstream transcribed regions encoding RNA transcript (coding region)

Promoter region

where transcription factors (proteins) bind and regulate gene expression

Coding region

a DNA sequence that transcribes a RNA transcript coding for a protein

Start codon

ATG

Stop codons

TAA, TAG, or TGA

Monocistronic prokaryotic genes

encode one protein product in a single RNA transcript. One gene under one promoter

Polycistronic prokaryotic genes

encode multiple protein products in a single RNA transcript under one promoter region. Multiple genes under one promoter, however genes are related

Eukaryotic gene consists of

• upstream regulatory sequences

• promoter sequences

• 5’ UTR upstream & 3’ UTR downstream of coding sequences

• gene sequences consist of exons (coding sequences) and introns (non-coding sequences that must be removed by splicing)

mRNA transcript processing in eukaryotes involve the following

• removal of introns (splicing)

• rejoining of exons to make continuous coding sequences

• addition of 5’ cap

• addition of 3’ poly(A) tail

BLAST

• basic local alignment search tool

• the program compares nucleotide or protein sequences to sequence databases and calculates the statistical significance

• BLAST can be used to compare genomic sequences

• useful in understanding the role of the gene and designing drugs to target gene products

Polymorphism

mutations that occur within the genome

Single nucleotide polymorphisms (SNP)

when one mutation occurs due to substitutions, deletions, and insertions in the genome. Can be used to generate molecular fingerprint of an organism

Short tandem repeats (STR) - microsattelite DNA

GATGATGATGATGATGATGAT (7 repeats)

Variable number tandem repeats (VNTR)

• repeats of a core sequence (16-64 bp)

• can be used in forensic applications

Conjugation

transfer of DNA from one bacterium to another through direct contact

Transduction

transfer of DNA to bacteria through bacteriophage (virus)

Transformation

introduction of exogenous DNA into a bacterial cell from its environment through a plasmid

Plasmid

• extra chromosomal, circular, double-stranded DNA

• self-replicating DNA

• can carry extra genetic information

• found in both prokaryotes and eukaryotes

• can be cloned, conjugated, transformed, or transduced

Common elements of plasmids

• ori - origin of replication

• antibiotic resistant gene (selective marker)

• β-galactosidase (Lac Z gene)

• MCS - multiple cloning sites

• insert

• promoter

Plasmid insert

gene of interest inserted into the plasmid

Plasmid promoter

found only in expression plasmid that can code for a protein

Cloning plasmid

good making copies of DNA

Expression plasmid

good for making protein of interest