Genes and the genetic code

WHAT IS A GENE?

▪ Classical genetic definition: a gene is a “hereditary factor that specifies an inherited trait”

▪ Inherited: passed from parent to offspring

▪ The collective effects of these traits affect our appearance, physiology, behaviour, and health

Discovery that genes encode proteins

“Normal” red blood cell vs Red blood cell from a person with Sickle-cell anemia

• Genetic variant changes 7th amino acid (aa) of β-globin from Glutamate to Valine (Note: 7th aa of nascent β-globin becomes 6th aa in mature β-globin)

• Discovery of this amino acid change led to “one gene-one polypeptide” theory

The human genome

▪ 6.5 billion base pairs on 46 chromosomes

▪ All of the instructions needed to make a human, written in a 4-letter alphabet

▪ What is written in this DNA?

Directional Flow of Genetic Information

▪ Genes are templates for the synthesis of an RNA molecule

▪ All genes are written in DNA and encode an RNA product

▪ Many RNAs encode proteins

▪ These are called messengers RNA (mRNA)

▪ Sometimes, the RNA itself is the final product

▪ The principle of directional information flow from DNA to RNA to protein is the “central dogma of molecular biology”

“Reversal” of the central dogma

▪ Transcription: a DNA template is used to make RNA

▪ Reverse transcription: an RNA template is used to make DNA (catalyzed by the enzyme reverse transcriptase)

▪ Retrotransposons are genetic elements that are transposable (able to move from one site to another within a genome) by processes involving reverse transcription

▪ Retroviruses have RNA genomes that must be reverse transcribed to make DNA

▪ Example: HIV particles contain no DNA, but eventually get reverse transcribed and integrate into the host cell genome

The Reproductive Cycle of a Retrovirus.

➊ Virus binds to the surface of the host cell, and its envelope fuses with the plasma membrane, releasing the capsid and its contents into the cytosol.

➋viral reverse transcriptase catalyzes a double-stranded DNA version of the viral genome.

➍ This double-stranded DNA then enters the nucleus and integrates into the host cell’s chromosomal DNA, The integrated viral genome is called a provirus

➎ Transcription of the proviral DNA produces RNA transcripts that function in two ways. First, they serve as

➏ mRNA molecules that direct the synthesis of viral proteins (capsid protein, envelope protein, and reverse transcriptase).

Second, ➐ some of these same RNA transcripts are packaged with the viral proteins into new virus particles.

➑ The new viruses then “bud” from the plasma membrane without necessarily killing the infected cell.

What is a gene? ▪ Modern molecular definition:

▪ Genes are functional units of DNA that encode one or more polypeptide chains or functional RNA

▪ A gene also includes DNA sequences called regulatory elements that act as instructions

▪ When and where to transcribe the gene

Major RNA products in the cell:

▪ mRNA: messenger RNA

▪ rRNA: ribosomal RNA

▪ tRNA: transfer RNA

▪ Other classes of noncoding RNA exist

▪ mRNA encode proteins

▪ rRNA are components of ribosomes

▪ tRNA are used during protein synthesis

How does a DNA sequence encode protein?

▪ The genetic code is a set of rules that describes the relationship between base sequence in a DNA polymer and the order of amino acids in a polypeptide

▪ There are 4 DNA bases but 20 amino acids…

▪ 1:1 would allow for only four amino acids

▪ 2:1 would allow for only 16 amino acids

▪ The triplet code, in which combinations of 3 bases specify amino acids allows 64 possible combinations

▪ More than enough for all 20 amino acids

▪ Example of a triplet: 5’-GGC-3’ codes for glycine

template strand

• The DNA genome is a double stranded polymer

• The strand that is used as a template to synthesize RNA is called the template strand

The triplet code

▪ Each triplet of RNA nucleotides – called a codon – codes for:

1. “Start” of a polypeptide (start codon)

2. An amino acid

3. “Stop” of a polypeptide (stop codon)

▪ Triplets between a start and stop codon are called an open reading frame

Mutations:

▪ Mutations: changes in the base sequence of a DNA molecule

▪ Examples: Wild type: ATGCGCATCGTCAAGTCCCGTC

Substitution: ATGCGCATCATCAAGTCCCGTC

Deletion: ATGCGCATC TCAAGTCCCGTC

Insertion: ATGCGCATCGGTCAAGTCCCGTC

Changes in the base sequence of DNA can lead to changes in the amino acid sequence of the encoded protein

non-overlapping

Nucleotides within triplets are non-overlapping

Triplets are susceptible to frameshift mutations

A gene requires a ___ to be transcribed

A gene requires a promoter to be transcribed

▪ To be expressed genes must be transcribed

▪ Enzyme: RNA polymerase

▪ Eukaryotes have three RNA polymerases: I, II, and III

▪ Protein-coding mRNAs are transcribed by RNA polymerase II (II = two)

▪ Promoters are DNA sequences that indicate where RNA polymerase should start transcribing ▪ Required for gene expression

mRNAs generated by RNA polymerase II must be ____ during and after transcription

mRNAs generated by RNA polymerase II must be processed during and after transcription

▪ Newly made RNA is called a primary transcript

▪ Most primary transcripts undergo RNA processing

▪ RNA polymerase II transcripts undergo extensive RNA processing to make a mature mRNA

▪ 5’ cap, 3’ polyadenylation, Splicing

What’s in a genome?

Only ~1.5% of the human genome represents protein-coding exons, rRNA, or tRNA Much of the genome encodes repetitive DNA

• ~50% of our genome is “selfish” DNA that can move between chromosomal locations (called transposons) 44% interspaced repeated DNA, 10% Alu elements

15% Unique noncoding DNA e/g long non-coding RNASA

15% Tandemly repeated DNA e.g telomeres and centromeres

24%introns and regulatory sequences

1.5% exons