PBS Semester Final Study Guide

A point of origin is one strategy a forensic scientist will use to ensure_________________.

A point of origin is one strategy a forensic scientist will use to ensure_________________.

that their measurements are specific enough that they could recreate the scene.

Using the image below: What is the scale used to draw this room accurately?

1 small square to 1 foot

Method seeking to find associations between evidence. Investigators evaluate the scene and then proceed through the area in a systematic and logical fashion. Based on the notion that one type of evidence leads to another. Works with large and small, indoor and outdoor crime scenes.

Link method

Used on large, outdoor crime scenes. Members of the search team are arranged at regular intervals, usually arm's length, and then proceed to search along straight lines

Line method

Used on large, outdoor crime scenes. Searchers follow the first line pattern and search in the same manner as the line method. Once the first line pattern is complete, searchers realign on the other line pattern.

Grid method

Used on crime scenes that are comprised of readily definable zones, such as in houses or buildings. Teams are assigned small zones for searching, and then other appropriate searching methods are employed in each zone.

Zone Method

Used on crime scenes with no physical barriers, such as open water. Can either begin at critical point of crime scene (outward spiral) or the outer-edge of the crime scene (inward spiral).

Spiral Method

Used on small, circular crime scenes. Investigators start from a critical point and travel outward along many straight lines from this point.

Wheel or Ray Method

Why is it important to establish a baseline for vital signs before running an official polygraph test?

Everyone body is different and you want to base the data off of what is normal for their body.

Are polygraph tests admissible in court?

No

You have established a baseline with your subject, then have ran your polygraph test. What physiological responses are you looking for if someone is lying?

Anything different from their baseline!

This is Eric Piedmonts baseline graph: This is Eric Piedmonts graph after asked if he killed Anna: Based off of these two graphs was Eric lying?

his vitals are higher however that just means he is possibly lying.

Using image above: Match the letter to the correct part of the hair.

Cortex: a,

Medulla: b,

Cuticle: c

Hair Growth

Anagen

Follicle Shrinks

Catagen

Hair Sheds

Telogen

What type of ridge pattern does this fingerprint have?

Loop

What is this minutiae

eye

What is this minutiae

delta

What is this minutiae

fork

What is this component of blood

Red blood cell

What is this component of blood

Platelet

What is this component of blood

Plasma

A minute, colorless, anucleate disk-like body of mammalian blood that assists in blood clotting by adhering to other platelets and damaged epithelium.

Thrombocyte

One of the many cells in the blood that lack hemoglobin but have a nucleus and are active in the immune response.

Leukocyte

Red blood cells that transport oxygen through a body.

Erythrocyte

The pale yellow, liquid portion of blood that consists of water and dissolved substances, including sugars, lipids, metabolic waste products, amino acids, hormones, and vitamins.

Plasma

You fall down and scrape your knee. Which component of blood would work to clot the blood at the injury site to generate a scab?

Thrombocyte

You complete blood type testing and there is no agglutination with either anti-A or anti-B. What type of blood is present?

Type O

People with Type AB blood are considered "universal recipients", meaning their bodies can accept every other type of blood. Why is this the case?

they produce neither anti-A and anti-B antibodies

Using the graph below, if you found blood droplets at the crime scene that measured 18mm in diameter. What height would the blood fallen from in cm?

120cm

DNA is cut at specific nucleotide sequences by a _________?

Restriction enzyme

When running a gel electrophoresis, DNA will migrate towards the ________ end because DNA has a __________________ charge.

positive, negative

What characteristic separates DNA fragments during gel electrophoresis?

length of fragment (# of base pairs)

Gel electrophoresis is used to separate the fragments of DNA. The larger pieces of DNA will travel ______________ through the gel.

Slower than the smaller fragments

Scientists are able to produce millions of copies of a specific DNA sequence from a small amount of DNA through

Polymerase Chain Reaction

Given the DNA strand GAATTCCTCGAG, what would be the complimentary strand to make the double stranded DNA?

CTTAAGGAGCTC

What property of DNA causes it to migrate to the positive pole of the electrophoresis apparatus?

the negative charge of the phosphate groups

The smaller the DNA fragment, the

further it moves down the gel

Which suspect should be convicted for a crime based on the DNA profile in Image 3?

4

In Image 2, what is the part labeled x known as?

Nucleotide

Cytosine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be Guanine?

38%

In the DNA Extraction lab, what was the purpose of the detergent?

Dissolve the cell and nuclear membrane

When performing DNA Extraction: What do you add to get the DNA to precipitate out of solution, and form a layer on top?

cold ethanol

What evidence found at the crime scene would contain DNA?

Blood

What type of chemical bond is found between paired bases of the DNA double helix?

hydrogen

Which of the following is NOT found in DNA?

chromosome

Which of the following bases is a purine?

guanine

Using the image above, What number represents a deoxyribose?

2

A certain restriction enzyme cuts DNA at the following sequence: TT /AA AA /TT If we used this enzyme to cut following piece of DNA, then how many RFLPs would there be CCGAATTATGCTTAACGAATGCCCGATACTTAAGC

GGCTTAATACGAATTGCTTACGGGCTATGAATTCG

3

Using the RFLPS from the previous question:

If we were to run gel electrophoresis using the restriction enzyme samples from the previous question, what would you expect to see on your gel?

3 bands. The first band= 13bp, the second band=18bp and the third band= 4bp.

The number of hydrogen bonds that connect A to T

2

Put these terms in order by size smallest to largest.

Gene, DNA, Genome

There is some controversy between who discovered the helical shape of DNA, however who are the official scientists who discovered the structure of DNA?

Watson and Crick

When using a micropipette you are suppose to pick your sample up by pushing the plunger to the "first stop".

True

Which step of an autopsy includes recording hair color, tattoos and/or birthmarks?

External Exam

An autopsy involves looking at organs or tissues with the naked eye before any microscopy examination occurs. What type of examination is this called?

Gross

Manner of death

Circumstances of death. Natural, homicide or accidental.

Mechanism of Death

What happened within the body to cause death. Heart stops beating.

Cause of death

Injury, trauma or disease that directly effect's the body.

There was a fatal car accident where the driver's head hit the steering wheel which caused massive trauma to the brain. Match the cause, mechanism and manner of death to the situation:

Traumatic brain injury (TBI)

Mechanism of death

There was a fatal car accident where the driver's head hit the steering wheel which cased massive trauma to the brain. Match the cause, mechanism and manner of death to the situation:

Car wreck/head hitting steering wheel

Cause of death

There was a fatal car accident where the driver's head hit the steering wheel which cased massive trauma to the brain. Match the cause, mechanism and manner of death to the situation:

Accidental death

Manner of death

Work with the medical examiner to piece together a timeline for when Anna most likely died. Remember that the emergency call came in at 10:00 a.m. The police and the EMT arrived at the scene at 10:10 a.m. and found Anna Garcia face down in the research lab. It was a comfortable 70˚F inside the research lab despite it being 92˚F outside. Investigators at the scene also noted that her body was in full rigor mortis with fixed lividity on the front side of her body. The medical examiner measured Anna's rectal temperature to be 78.2°F at 11:30 a.m. USE THE EQUATION BELOW TO DETERMINE HOW MANY HOURS SINCE DEATH Glaister Equation: The Glaister equation is one formula used to approximate the postmortem interval, the time since death. This equation uses degrees Fahrenheit. (98.4- rectal temp) / 1.5= approximate hours since death

13.5 hours since death

Use your answer from the previous question to help you. What is the approximate time of death for Anna Garcia?

10 pm

Which of the following refers to blood pooling or settling in the body?

Livor mortis

At what point does the body turn blueish-greenish and start to smell as it bloats?

Decomposition

Match the time with the state of the dead body:

2-4 hours

Corneas FULLY cloud and livor mortis intensifies

Match the time with the state of the dead body:

0-30 mins

Algor mortis- body begins to cool

Match the time with the state of the dead body:

Rigor mortis ENDS

36 hours

Match the time with the state of the dead body:

36-48 hours

Decomposition begins, you start to see larval stages of blowflies

What are the preferred organs that can be used to determine body temp of a corpse?

Rectum, brain, liver

Hair, skin and nails

Integumentary system

Filter fluids of body to remove and defend against foreign invaders

Lymphatic system

Vagina, penis, ovaries, testis

Reproductive system

Removes waste from body, balances amount of water in the body

Urinary system

Physical digestion is the breaking apart of food through chemical reactions using acids and enzymes. True or False?

False

Which organ in the digestive system is a sac surrounded by muscle that has acids and enzymes to break down food?

Stomach

Which organ in the digestive system reabsorbs water and makes poop to be excreted?

Large intestine

What is the correct order of the organs in the digestive system?

Oral Cavity, Esophagus, Stomach, Small Intestine, Large Intestine.

The peripheral nervous system (PNS) contains all of the nerves in the body. This includes both the nerves that run to the brain and the nerves that run away from the brain to the rest of the body. True or False?

True

Green

Temporal lobe

Blue

Occipital lobe

Pink

Parietal lobe

Yellow

Frontal lobe

Place the terms in order from smallest to largest. organ system, cell, organ, tissue.

cell, tissue, organ, organ system

There are two methods used in a gross examination of a brain during an autopsy. One method is an MRI scan, what is the other method?

Cross Section

Connective tissue

Supports other tissues.

Nervous tissue

Sends and receives signals.

Muscular tissue

Provides structure and movement.

Epithelial tissue

Absorbs, secretes, protects, and senses.

What is this tissue

Connective

What is this tissue

Nervous

What is this tissue

Muscular

What is this tissue

Epithelial

Frontal lobe function

Planning section, regulates emotions and behavior

Parietal lobe function

Sensory and visual information

Occipital lobe function

Processes information from eyes

Temporal lobe function

Processes language and long term memory

All arteries carry oxygenated blood except the _____________________

Pulmonary artery