DNA Replication

conservative model

parental strands stay together after replication

semiconservative model

after replicaton DNA has 1 parental and 1 daughter strand

dispersive model

parental and daughter DNA strands are interspersed

in DNA replication, each strand is used as a ____________ to produce two ____________ DNA molecules

template, identical

DNA replication relies on

base complementarity

DNA replication begins at the ____________ of ____________

origin of replication

3 regions of oriC

AT rich region, DnaA boxes, and GATC methylation sites

Eukaryotes have ____________ origins of replication

multiple

origins of replication in eukaryotes

ARS elements and consensus sequences (AT rich regions)

inititation of DNA replication step 1

DnaA proteins bind DnaA boxes and each other

initiation of DNA replication step 2

replication fork opens at AT rich regions

What opens the replication fork? And what direction does the replication fork open in?

DNA helicase, 5' to 3' direction

DNA ____________ regulates replication

methylation

____________ sites are methylated on ____________ by the ____________ enzyme

GATC, adenine, DAM

initiation can only occur on fully ____________ ____________

methylated DNA

DNA helicase

unwinds double helix at replication fork and seperates DNA strands

topoisomerase II

ahead of DNA helicase and relieves supercoiling caused by helicase

single stranded binding proteins

bind DNA to keep strands seperated and supported

RNA primase

lays down RNA primers, 1 in leading multiple in lagging

DNA polymerase

synthesizes DNA

flap endonuclease

at 3' end of polymerase, removes RNA primers in eukaryotes

DNA ligase

covalently joins okazaki fragments

DNA polymerase can only add new nucleotides to the ____________ end of a growing strand, meaning it synthesizes DNA in the ____________ direction

3'. 5 to 3

since DNA is ____________, polymerase only building 5 to 3 is a problem

antiparallel

the leading strand must be the one in the ____________ direction so DNA can be synthesized 5 to 3

3 to 5

If the template strand is 3' TGACCATGGATCATACATT TGAC 5', then the new leading strand is

5'ACTGGTACCTAGTATGTAAACTG 3'

the lagging template strand is in the ____________ direction

5 to 3

Primosome

A protein complex at the replication fork whose central component is primase.

Replisome

group of proteins needed for DNA synthesis

since DNA polymerases can only synthesize ____________ and can't initiate DNA synthesis on a ____________ strand, telomeres can not be replicated

5 to 3, unprimed

at the 3 prime overhang, there is no room for a ____________ to be placed

primer

Telomerase

adds both RNA primers and free DNA nucelotides within the same enzyme

germ cells

reproductive cells

telomerase is a reverse ____________

transcriptase

errors in replication are ____________

rare

base pairs are very ____________ , so mismatches are less ____________

stable

exonuclease

removes incorrect nucleotides to fix incorrect bases

helicase and ____________ stay together

primase

how is eukaryotic replication regulated?

ORC (origin recognition complex binds to origin )