DNA unit

revision of terms from DNA unit - science term one

what is DNA? (+ where is it stored)

DNA (deoxyribonucleic acid) is a complex molecule that contains genetic information, which is stored in the nucleus of a cell.

what is DNA made up of?

phosphate, five-carbon sugar, and an organic base.

what are the bases?

ATGC - adenine, thymine, guanine and cytosine

what are the complementary base pairs?

AT & GC - adenine + thymine & guanine + cytosine

what is a hydrogen bond?

a type of weak chemical bond between two groups of atoms - when guanine and cytosine bond, they require 3 bonds instead of 2, unlike adenine and thymine

what is a gene?

* a section of DNA that provides instructions to a cell for building a specific protein. *

(each protein plays a certain role in an organism - e.g. hemoglobin proteins transport oxygen in the blood)

genes are like packets of genetic information that can be passed between generations.

what is a nucleotide?

a sub-unit of DNA

what is a double helix?

the sugar-phosphate backbone of one nucleic chain attached to a second chain, forming a ladder-like structure

what is the nucleotide that bonds with adenine?

thymine

what is the nucleotide that bonds with guanine?

cytosine

write the complementary pairs:

ATAGCGTCAACTGTCACCCT

TATCGCAGTTGACAGTGGGA

what is mitosis?

cell division that provides cells for growth and repair

what is meiosis?

cell division that produces sex cells for reproduction

what are somatic cells?

cells (not sperm/eggs)

what are gametes?

sex cells (eggs/sperm)

what is a haploid?

cells with one set of chromosomes

what is a diploid?

cells with two sets of chromosomes

what are the phases of mitosis? (in correct order)

prophase (1), metaphase (2), anaphase (3), telophase (4), cytokinesis

what is interphase?

occurs between divisions. it is the longest part of the cycle, and the “normal life” of the cell. DNA replication happens here.

what is prophase, and what phase is it?

phase 1 - chromosomes appear, nuclear membrane disappears and spindles form

what is metaphase, and what phase is it?

phase 2 - chromosomes line up down the middle of the cell

what is anaphase, and what phase is it?

phase 3 - each pair of chromatids are separated at the centre and move to the opposite pole

what is telophase, and what phase is it?

phase 4 - nucleus membrane reforms

what is cytokinesis, and what phase is it?

trick question! cytokinesis and interphase are not technically counted as “phases” - cytokinesis is when the cytoplasm divides into two, creating two separate yet genetically identical cells

what is an acronym used to remember the order of mitosis?

P - MAT - C (prophase, metaphase, anaphase, telophase and cytokinesis)

what cell does mitosis occur in?

somatic cells

what cell does meiosis occur in?

gametes

how many times does the cell divide in mitosis?

once - creating two separate cells

how many times does the cell divide in meiosis?

twice - creating four separate cells

how many chromosomes in daughter cells? (mitosis)

46 - diploid (< cells with 2 sets of chromosomes)

how many chromosomes in daughter cells? (meiosis)

23 - haploid (< cells with 1 set of chromosomes)

what are the phases in meiosis?

interphase, prophase, metaphase, anaphase, telophase, cytokinesis (FIRST PAIR), prophase II, metaphase II, anaphase II, telophase II, cytokinesis (SECOND PAIR)

what is an acronym used to remember meiosis?

P - MAT - C x2

what is a genotype?

the genes in an organism - the dominant allele is written as a capital (e.g. purple flower - P) and the recessive allele is written as a lowercase (e.g. white flower - p)

what does homozygous mean?

a genotype of identical alleles (PP or pp)

what does heterozygous mean?

a genotype of different alleles (Pp)

what is a phenotype?

describes what the organism looks like - e.g. for the bellflower, Pp & PP means the flower would be purple and pp means the flower would be white

what are punnet squares?

they are used to show breeding pairs and offspring - e.g. when clasping hands, left thumb on top is dominant over right thumb on top

make a punnet square and then check your answer for the following:

left thumb on top for parent 1 (AA)

right thumb on top for parent 2 (aa)

[ ] | A | A → genetic contribution of one parent

a | Aa | Aa }

a | Aa | Aa } offspring genotype possibilities

^ genetic contribution of the other parent

what is an allele?

a version of a gene; a person inherits two alleles for each gene, one coming from each parent

what is a dominant trait?

a characteristic that needs only one copy of an allele to appear in the physical appearance of an organism

what is a recessive trait?

a characteristic that is only expressed in the phenotype when two identical alleles are inherited

what are autosomal chromosomes?

all of the first 22 pairs of chromosomes - a chromosome that stores your genes, but not those that determine sex

what are sex chromosomes?

chromosomes that determine the sex of an organism

what is the genotype for the sex chromosomes in female?

XX

what is the genotype for the sex chromosome in males?

XY

what are the differences between autosomal and sex-linked traits?

autosomal traits exist in someone regardless of their sex (e.g. dimples and ear lobes). sex-linked traits exist in someone because of their sex (e.g. muscular dystrophy)

what does autosomal dominant mean in terms of inheritance?

an allele that will physically present with one of two copies in the genotype (GG or Gg)

what does autosomal recessive mean in terms of inheritance?

an allele that will only physically present with two copies in the genotype (gg)

what does it mean when something is X-linked dominant?

the dominant allele is on the X chromosome

what is does mean when something is X-linked recessive?

the recessive alleles are on both X chromosomes (< females; in males, the Y chromosome lets whatever the X allele is to be dominant - therefore, only one recessive allele is required)

a male’s phenotype will match whatever the allele on the X chromosome is for a specific trait. XR = normal eyesight, Xr = colourblind

therefore, what does XRY mean?

the male has normal eyesight

what are pedigrees?

family trees that show how a trait is passed down by studying genetic patterns

what are the symbols shown in pedigrees?

white square = male

white circle = female

shaded square = male, presence of trait

shaded circle = female, presence of trait

line drawn between two symbols = partners

what does the term 'genetic code' mean?

the sequence of nucleotides in DNA, inherited from parent organisms

what is transcription?

the process of copying the DNA that makes up a gene to messenger RNA

what is translation?

the formation of a protein from RNA

what is a codon?

a group of three nucleotides on mRNA

what is a mutation?

a permanent change in the sequence or amount of DNA

in the process of transcription, DNA gets copied into:

RNA

what are the types of mutations?

frameshift and point

in sex-linked inheritance, if a female has a heterozygous genotype for a trait this is called being a

carrier

a point mutation is a change to:

a single base

insertion is a type of point mutation where:

a base is added to a sequence

which types of point mutation can cause a frameshift?

insertion (addition of a base) and deletion (removal of a base)

a frameshift caused by a point mutation will result in the protein not functioning properly because

all amino acids after the changed base are likely to be different

if a sequence of bases in a gene is normally

AGUCACC

and a point mutation changes it to

AGCACCU

what type of mutation has occured?

deletion

what is one difference between DNA and RNA?

DNA is double stranded and RNA is single stranded

where does a cell build the proteins it needs?

in ribosomes in the cytoplasm

which of the following could be codons:

TCA, GCG, DNA or ATTGCATC

TCA and GCG

what are the building blocks of proteins?

amino acids

what is the outcome of transcription?

RNA molecule