Genetics (224) Lectures 6+7 (up to slide 16)

Recombinational/linkage maps

Represent the relative location of alleles on a chromosome (distance between alleles measured in map units)

What is the difference between crossing over and recombination?

Crossing over refers to the physical event of breakage and rejoining of DNA between homologous chromosome pairs during meiosis (switching chromosome segments), while recombination refers to genetic reshuffling that can result from crossing over and independent assortment. A double crossover may even reverse the initial swap of genetic material, resulting in no recombination

Crossover products

Chromosomes with new combinations of alleles resulting from recombination during meiosis

Chiasma

The X-shaped, microscopically visible region between diyad nonsister chromatids that have exchanged genetic material through crossing over during meiosis

Cis conformation

In individuals heterozygous for 2 linked genes, the dominant alleles are on the same chromosome while the recessive alleles are on the other chromosome (AB/ab)

Trans conformation

In individuals heterozygous for 2 linked genes, one dominant and one recessive allele are on each of the 2 chromosomes (Ab/aB)

Map units (cM)

Centimorgans (should be called centisturtevants), 1 unit is equivalent to 1% recombinant, indicates relative distances between alleles on linkage map

Recombinant frequency

The percentage of offspring with different genotypes from the parents because crossing over has occurred

Interference (I)

A measure of how much the occurrence of one crossover event prevents another crossover nearby (I=100% - COC)

Coefficient of coincidence (COC)

Ratio of how often double crossovers actually occur versus how often they're expected to occur (observed double crossovers/expected*100%)

Octad

An ascus containing eight ascospores, produced in species in which the tetrad undergoes a postmeiotic mitotic division

First division segregation patterns (M1)

When there is no crossing over between the allele locus and the centromere in tetrad meiosis (eg. ordered ab, aB, Ab, AB w/r/t a)

Second division segregation patterns (M2)

When there is crossing over between the allele locus and the centromere in tetrad meiosis (eg. ordered ab, aB, Ab, AB w/r/t b)

Parental-ditype (PD) tetrad

Group of 4 spores where the 2 types of genotypes present are identical to the parents

Non-parental ditype (NPD)

Group of 4 spores where the 2 genotypes present are different from the parents

Tetra type (TT)

Group of 4 spores where all 4 genotypes are different

What does it indicate if PD is larger than NPD in tetrad analysis?

The alleles are linked. If PD=NPD, the genes are unlinked

Restriction fragment length polymorphisms (RFLPs)

DNA from homologous chromosomes that have been digested by restriction endonucleases and is analyzed to show different fragment lengths, indicating differences in the sequences of homologous chromosomes

Molecular markers

Specific sequences of DNA that can be used to detect non-phenotypic genetic differences

Single nucleotide polymorphisms (SNPs)

Most common type of genetic variation, where a single base pair in the DNA is altered

Sequence length polymorphisms

Differences in DNA sequence length caused by repetitive segments where the number of tandem repeats vary between individuals

SSLPs/VNTRs

• Simple sequence length polymorphisms/Variable number tandem repeats

• Refer to regions of repetitive DNA, where the number of repeats varies between individuals

• 2 types: microsatellites and minisatellites

Minisatellite markers

• Tandemly repeated DNA sequences where each repeated sequence is between 15-100 nucleotides long and repeats multiple times

• The total repeat region spans 1-5 kilobases (kb)

• Ex. (ATGGATCCATGCATGAGATAAGC)*30 (or some other number)

Microsatellite markers

• Tandemly repeated DNA sequences where each repeated sequence is between 2-5 nucleotides long and repeats multiple times

• Ex. CACACACACACA…

Heteroduplex DNA

• Temporary recombinant double stranded DNA in which there is one or more mismatched nucleotide pairs

• Caused by hydrogen bonding of DNA from 2 parents during meiosis in fungi

Physical map

A genetic map with the actual physical distances between alleles, measured in base pairs (or kilobase pairs)

Conjugation

• Bacterial boinking

• One cell (donor) transfers genetic information to another (the recipient)

• Transfer plasmid through sex pilus

Fertility factor (F)

• Genetic information that confers donor ability for conjugation

• Gene encoding pilus formation

• F+=donor, F-=recipient

Rolling circle replication

• Process of replicating circular DNA

• Primer for leading strand created by nicking piece of DNA from parental chromosome

• Leading strand continuously synthesized, converted to double-stranded DNA

High frequency recombinants (Hfr)

• Strain of bacterial cells resulting from the F plasmid inserting/recombining into the bacterial chromosome

• Capable of transferring chromosomal genes at a high frequency through conjugation

Exconjugants

Recipient cells resulting from gene transfer in which donor cells carrying specialized plasmids establish contact with and transfer DNA to the recipients

Interrupted matings

• Demonstrate that specific genes in an Hfr strain are transferred and recombined sooner than others

• On the original host bacteria of the chromosome, these genes were right next to each other or close

• Later donor alleles are present in fewer recipient cells

Exogenate

External DNA that is donated to a recipient

Endogenate

DNA that already exists in the genome of the recipient cell

Merozygote

Partial diploid; has two copies of some gene(s)

How can bacteria become merozygotic?

When the F plasmid leaves a bacterial chromosome, sometimes it takes a small piece of the chromosome with it (becoming F'). So when that is transferred to the recipient, the recipient also receives a bit of the first host's DNA and now has 2 copies of the same segment of DNA (one of its own, one from the old host)

F'

F plasmid that has been excised from the host's chromosome, but contains a wee bit of the host's DNA

R plasmids

A bacterial plasmid carrying genes that confer resistance to certain antibiotics

Why is recombination less common in bacteria compared to eukaryotes?

Eukaryotes obviously have more opportunities for recombination (like meiosis), but also because bacteria have circular chromosomes. Bacteria require double recombination (way less likely than single recombination) or else their chromosomes will become linear and be destroyed by nucleases

Positive control of transcription

Involves an activator protein binding to regulatory DNA sequence and initiating transcription of a gene

Negative control of transcription

Involves a repressor protein binding to regulatory DNA sequence and preventing transcription of a gene

Promoter

Region of DNA upstream of transcription used to control RNA polymerase binding. Signals where to begin transcription

Genetic switches

• Regulatory mechanisms that turn genes on or off in response to environmental signals

• Typically involve regulatory proteins (activators or repressors) binding to specific sequences (promoters, operators)

Activator proteins

Proteins that bind to regulatory DNA sequences to enhance transcription. Physically interacts with RNA polymerase

Repressor proteins

Regulatory proteins that inhibit transcription by binding to the operator site and blocking RNA polymerase

DNA binding domain

Part of protein that binds to specific target DNA sequences (such as the operator)

Allosteric site/domain

Part of protein that can be bound to by molecules that change the tertiary structure of the protein and alter ability to bind to DNA

Allosteric effectors

Molecules that bind to the allosteric site of a protein, changing its ability to interact with substrate (or in this context, DNA)

Coordinately controlled

A group of genes with related function that are all turned off or on at the same time in response to the same signals

Inducer

A specific small molecule that binds to a repressor protein and changes the repressor's shape so that it cannot bind to an operator, derepressing it (ex. allolactase binds the LacI repressor, causing it to pop off the operator, allowing transcription)

Allosteric transition

The change in shape of a protein (and therefore change in function) caused by the binding of a regulatory molecule on an allosteric site

Operator region

DNA sequence upstream of genes (after promoter and before start site) where repressors can bind to block transcription

Constitutive expression

• Genes that are always expressed without regulation

• Usually vital genes that are necessary regardless of environmental conditions

• Ex. O^c mutation in the lac operon prevents the operator from being bound by a repressor, so the operon is always expressed

Cis-acting

A regulatory DNA sequence (or rarely a protein that for some reason can only interact with one DNA molecule) only able to control the expression of genes downstream on the same DNA molecule

Trans-acting

A regulatory protein that can diffuse and interact with operators on different DNA molecules (can interact with both molecules in a partial diploid)

Polar mutations

• Mutations affecting the expression of genes located further downstream in an operon

• Ex. a nonsense mutation in lacZ would cause RNA pol. to fall off, preventing the transcription of lacY and lacA

Catabolite activator protein (CAP)

A protein that activates transcription when bound to cAMP when glucose levels are low, recruiting RNA pol. to the promoter

Cyclic adenosine monophosphate (cAMP)

A signalling molecule that accumulates when glucose levels are low, which binds to CAP to activate transcription

CAP-cAMP complex

Binds to CAP binding site and enhances the promoter's affinity for RNA polymerase, activating transciption when glucose levels are low

CAP binding site

DNA sequence in the promoter region upstream of certain operons (such as the lac operon) where the CAP-cAMP complex binds. Positive control (activation) of the operon occurs here

Catabolite repression

The presence of glucose represses the activation of alternative metabolic pathways (ex. the lac operon) because the CAP-cAMP complex doesn't bind to the promoter region to attract RNA pol