Biomed Midterm Study Guide

You are called to a crime scene with a single victim in the middle of a large, flat desert with no hills or trees. The

victim is 500 meters from the nearest road with a few scattered objects immediately visible around the body and

footprints scattered in between the road and the body. Which search method would you use and why?

Grid search because iit allows for a thorough examination of the area

Which search method would most likely be used in a house?

Zone search - house is divided into smaller sections

Why are polygraph results not always permissible in court?

They are considered scientifically unreliable

What are the 4 physiological responses that could indicate a person is lying?

Increased heart rate, sweating, changes in breathing, blood pressure

Which search method would best be used to search for evidence/bodies in a boat wreck in

open water?

Spiral search

If blood does not agglutinate in the anti-A well, but does agglutinate in the anti-B well, which

blood type is present in the tray?

type b blood

What type of fingerprint is this?

Whorl

What system is responsible for eliminating waste from the body and regulating water balance of blood

Urinary system

The _________________________________________ is the location in the crime scene

where from which you take all measurements.

Baseline measurements

What does DNA's chemical code provide the instructions to build?

Proteins

Using the image below which of the following patterns is seen in the fingerprint?

tented arch

What are the four nitrogenous bases of a DNA double helix?

Adeninie thymine cytosine and guanine

Which is NOT an example of trace evidence?

Footage, eyewitness, large identifiable figerprint

EcoRV is a restriction enzyme that cuts DNA at the sequence 5’ GATATC 3’ to produce the cleavage: 5’ GAT ATC 3’. How many fragments of DNA would be produced if the following sequence was exposed to EcoRV?

CTGGATATCTATAGGTCGATATCCCTGCA

CTGGATATC TATAGGTCGATATC CCTGCA 3

What happens physiologically (inside the body) to result in death is the:

Vital organs stop functioning heart stops

What is the pathway for a drop of deoxygenated blood to become oxygenated back into the body?

superior and inferior vena cava -> right atrium -> tricuspid valve -> right

ventricle -> pulmonary valve -> pulmonary artery -> lungs -> pulmonary veins

-> left atrium -> mitral valve -> left ventricle -> aortic valve -> aorta

What are sources of DNA that can be collected from a crime scene and used as potential means for identifying a person of interest in a crime.

Blood, saliva, skin, hair, bodily fluids, fingernail,

personal items

What is the purpose of gel electrophoresis in forensic science? Know gel electrophoresis and how it appears in the gel

To seperate and analyze DNA fragments

What is the flow of blood in the pulmonary system?

deoxygenated blood goes from right ventricle to pulmonary

artery to lungs

What is the flow of blood in the systemic system?

oxygenated blood leaves left ventricle to aorta and travels

throughout the body through artery

What is Hypertension?

high blood pressure

What is the phase, Systole?

phase where the heart contracts

What is the phase, Diastole?

phase where the heart relaxes

what is the Systemic System?

oxygenated blood from the heart to the body

What is the Pulmonary System?

deoxygenated blood from the heart to the lungs

What are the Ventricles?

lower chambers of the heart that pump blood out to the lungs and the body

What are the Atria (Atrium)?

upper chambers that receive blood returning from the body or lungs

What are Platelets?

small disc shaped fragments in blood

What are Capilaries?

tiny blood vessels that connect arteries and veins-exchanges oxygen, CO2 and nutrients

What are Arteries?

blood vessels that carry deoxygenated blood away from the heart (expect pulmonary)

What are veins?

blood vessels that carry oxygenated blood back to the heart (except pulmonary)

What are Gametes?

reproductive cells (sperm and egg) that are haploid and unite during fertilization to form a zygote

What is a Zygote?

fertilized egg farmed by the fusion of a sperm and egg cells containing a diploid set of chromosomes

What are Centromeres?

sister chromatids are attached here

What is a Centriole?

a structure in animal cells that helps organize microtubes during cell divison

What is a sister chromatid?

2 identical copies of a single replicated chromosome

What is a chromosome?

structure found in the nucleus of most living cells made up of DNA and proteins.

What are the components of blood

plasma, red blood cells, white blood cells, and platelets

what is plasma?

Liquid portion containing water, proteins, electrolytes, nutrients, etc

What are red blood cells?

carry oxygen from the lungs to the rest of the body

What are white blood cells?

Part of the immune system and fights infections and protects the body

What is the main function of blood?

To transport oxygen ad nutrients to tissues, removing want unnecessary things

What is the Aorta?

main artery

What are the Pulmonary arteries?

deoxygenated blood from right ventricle to lungs

what is the superior and inferior vena cava?

carries deoxygenated blood to right atrium

what are the Pulmonary veins?

carry oxygenated blood from lungs to left atrium

What are the chambers of the heart?

right atrium, right ventricle, left atrium, and left ventricle

what is the right atrium?

receives deoxygenated blood

what is the right ventricle?

pumps deoxygenated blood to the lungs

what is the left atrium?

receives oxygenated blood from lungs via pulmonary veins

What is the left ventricle?

pumps oxygenated blood to the entire body via aorta valves

What are the valves?

tricuspid valve, pulmonary valve, mitral valve, aortic valve

What is the tricuspid valve?

located between right ventricle and atrium

What is the pulmonary valve?

Located between right ventricle and pulmonary artery

What is the mitral valve?

located between left atrium and ventricle

What is the aortic valve?

located between left ventricle and aorta

what are the general organelles?

nucleus, plasma membrane, ribosomes

What does the nucleus do?

contains the cell’s genetic material

what does the plasma membrane do?

lipid bilayer that surrounds the cell, controls movement

what do ribosomes do?

responsible for protein synthesis

What is the cell cycle?

consists of stages through which a cell passes to divide and reproduce

What does interphase consist of?

G1 (Gap 1), S (Synthesis), G2 (Gap 2)

What does G1 phase consist of?

Cell growth and normal functions

What does S phase consist of?

DNA replication

What does G2 phase consist of?

final preparations for mitosis

What phases occur in Mitosis?

Prophase, Metaphase, Anaphase, Telophase

What does Prophase consist of?

chromosomes condense and the nuclear envelope breaks down

What does Metaphase consist of?

Chromosomes align at the center

What does Anaphase consist of?

sister chromatids are pulled apart to opposite sides

What does Telophase consist of?

Nuclear envelope re-forms around the chromosomes

What is cytokinesis?

cytoplasm divides, resulting in two daughter cells

What is Mitosis?

A process of cell division that results in two genetically identical daughter cells, maintaining the same chromosome number (2n)

What is Meiosis?

A type of cell division that reduces the chromosome number by half, creating four genetically diverse gametes (sperm or eggs) with half the chromosome count (n)

what does Meiosis I include?

Prophase I, Metaphase I, Anaphase I, Telophase I

what is Prophase I (Meiosis)?

Homologous chromosomes pair up and exchange genetic material

what is Anaphase I (Meiosis)?

Chromosomes align in pairs.

what is telophase I (Meiosis)?

two haploid cells form

What is Meiosis II (similar to mitosis)?

Results in four non identical haploid cells