free scored fl bio section

The association observed experimentally between the expression of miRNAs and mRNAs in AR kidney transplants indicates that miRNAs regulate the expression of genes implicated in which type(s) of immune response(s)?

Numerous protein-encoding genes are regulated by miRNAs, including those involved in the immune response. Research has shown that rejection of transplanted organs is associated with alterations in the expression of various genes.

Figure 1  Expression levels of miRNAs in biopsy specimens of normal and AR kidney transplants
(Note: miRNA levels are normalized to the small nucleolar RNA RNU44; * indicates p < 0.05.)

Of these miRNAs, miR-142-5p, miR-155, and miR-223 are highly expressed in normal lymphocytes and monocytes, whereas miR-30a-3p, miR-10b, and let-7c are highly expressed in normal human renal cells.

• A.

  Adaptive immunity only

• B.

  Humoral immunity only

• C.

  Innate and cell-mediated immunity only

• D.

  Adaptive and innate immunity only

miRNA is linked to organ rejection so in the experiment shown in figure 1 acute rejection of liver was associated with specific miRNAS that was further broken down to be expressed in normal lymphocyte and monocytes which are adaptive immune cells T and B cells respectively

Based on Figure 1, which patient is LEAST likely to benefit from therapy with immunosuppressors?

A patient whose transplanted kidneys are associated with miRNA expression patterns characterized by:

• A.

  high levels of miR-155

• B.

  low levels of let-7c.

• C.

  high levels of miR-30a-3p.

• D.

  low levels of miR-10b.

C

A graph of miRNA/RNA denaturation versus melting temperature is shown.

The arrow in the graph indicates the curve representing the melting temperature for which miRNA, assuming 100% base complementarity with its target sequence?

miRNA	Sequence
miR-142-5p	5’–CAUAAAGUAGAAAGCACUACU–3’
miR-155	5’–UUAAUGCUAAUCGUGAUAGGGGU–3’
miR-223	5’–CGUGUAUUUGACAAGCUGAGUU–3’
miR-10b	5’–UACCCUGUAGAACCGAAUUUGUG–3’
miR-30a-3p	5’–CUUUCAGUCGGAUGUUUGCAGC–3’
let-7c	5’–UGAGGUAGUAGGUUGUAUGGUU–3’

• A.

  miR-142-5p

• B.

  miR-223

• C.

  miR-10b

• D.

  miR-30a-3p

D

Individual nucleotides within the backbone of the regulatory RNAs discussed in the passage are held together by:

• A.

  disulfide bridges.

• B.

  phosphodiester linkages.

• C.

  hydrogen bonds.

• D.

  glycosidic linkages.

B

Table 1

Bacteria Analyzed in the Large Intestine

Bacterium	Gram status	Energy source	Product
Roseburia*	positive	acetate	butyrate
Phascolactobacteria*	negative	succinate	propionate
Ruminococcaceae*	positive	PS + H+	acetate
Odoribacter*	negative	glucose and its isomers	acetate, propionate, butyrate, H2, H2S
Faecalibacteria*	negative	PS + glucosamine	butyrate
Clostridia**	positive	glucose	acetate
Enterobacter**	negative	PS	LPS + lactate

Note: indicates highly reduced, and * indicates highly increased number of bacteria in CD-affected individuals compared to healthy individuals. PS indicates polysaccharides, and LPS indicates lipopolysaccharides.

Adapted from X. C. Morgan, T. L. Tickle, H. Sokol, D. Gevers, K. L. Devaney et al., Genome Biology. ©2012 BioMed Central Ltd.

From Table 1, which bacteria can use galactose as an energy source?

• A.

  Ruminococcus

• B.

  Faecalibacterium

• C.

  Odoribacter

• D.

  Phascolactobacterium

C

Bacteria Analyzed in the Large Intestine

Bacterium	Gram status	Energy source	Product
Roseburia*	positive	acetate	butyrate
Phascolactobacteria*	negative	succinate	propionate
Ruminococcaceae*	positive	PS + H+	acetate
Odoribacter*	negative	glucose and its isomers	acetate, propionate, butyrate, H2, H2S
Faecalibacteria*	negative	PS + glucosamine	butyrate
Clostridia**	positive	glucose	acetate
Enterobacter**	negative	PS	LPS + lactate

Note: indicates highly reduced, and * indicates highly increased number of bacteria in CD-affected individuals compared to healthy individuals. PS indicates polysaccharides, and LPS indicates lipopolysaccharides.

Adapted from X. C. Morgan, T. L. Tickle, H. Sokol, D. Gevers, K. L. Devaney et al., Genome Biology. ©2012 BioMed Central Ltd.

From Table 1, in which metabolic process are GI tract bacteria directly involved?

• A.

  Conversion of PS into short chain fatty acids

• B.

  Absorption of amino acids

• C.

  Fermentation of dietary fibers into peptides

• D.

  Absorption of monosaccharides

A

Bacteria Analyzed in the Large Intestine

Bacterium	Gram status	Energy source	Product
Roseburia*	positive	acetate	butyrate
Phascolactobacteria*	negative	succinate	propionate
Ruminococcaceae*	positive	PS + H+	acetate
Odoribacter*	negative	glucose and its isomers	acetate, propionate, butyrate, H2, H2S
Faecalibacteria*	negative	PS + glucosamine	butyrate
Clostridia**	positive	glucose	acetate
Enterobacter**	negative	PS	LPS + lactate

Note: indicates highly reduced, and * indicates highly increased number of bacteria in CD-affected individuals compared to healthy individuals. PS indicates polysaccharides, and LPS indicates lipopolysaccharides.

Adapted from X. C. Morgan, T. L. Tickle, H. Sokol, D. Gevers, K. L. Devaney et al., Genome Biology. ©2012 BioMed Central Ltd.

Based on Table 1, what is most likely associated with a reduction in gram-positive bacteria?

• A.

  Increase in acetate production

• B.

  Increase in use of acetate

• C.

  Decrease in pH

• D.

  Decrease in PS production

C

Based on the passage, the microbiome of CD-affected individuals will result in which physiological change?

The microbiome has been investigated for its possible link to non-hereditary diseases. Crohn’s disease (CD) is a non-hereditary chronic inflammatory condition that may affect any part of the gastrointestinal (GI) tract.

• A.

  Increased polypeptide digestion

• B.

  Slower dietary fiber absorption

• C.

  Increased amount of propionate

• D.

  Decreased immune tolerance

D

Based on the passage, to which phylum does Enterobacter most likely belong?

bacteria Firmicutes and Bacteroidetes and a reduced amount of Proteobacteria and Actinobacteria. This is in contrast to the microbiome of individuals with CD who have an increase in the number of the gram-negative Proteobacteria, whereas the number of Firmicutes bacteria is highly reduced.

• A.

  Actinobacteria

• B.

  Firmiculate

• C.

  Bacteroidete

• D.

  Proteobacteria

D

Which product is particularly reduced in CD-affected individuals?

The GI tract microbiome of healthy individuals exhibits a predominance of gram-positive bacteria Firmicutes and Bacteroidetes and a reduced amount of Proteobacteria and Actinobacteria. This is in contrast to the microbiome of individuals with CD who have an increase in the number of the gram-negative Proteobacteria, whereas the number of Firmicutes bacteria is highly reduced. Treatment with 5‑aminosalicylic acid reduced Proteobacteria without affecting the number of other bacteria in CD‑affected individuals. Bacterial characteristics and variations in microbiome between healthy and CD‑affected individuals are summarized in Table 1.

Table 1

Bacteria Analyzed in the Large Intestine

Bacterium	Gram status	Energy source	Product
Roseburia*	positive	acetate	butyrate
Phascolactobacteria*	negative	succinate	propionate
Ruminococcaceae*	positive	PS + H+	acetate
Odoribacter*	negative	glucose and its isomers	acetate, propionate, butyrate, H2, H2S
Faecalibacteria*	negative	PS + glucosamine	butyrate
Clostridia**	positive	glucose	acetate
Enterobacter**	negative	PS	LPS + lactate

• A.

  Glucose

• B.

  Lactate

• C.

  LPS

• D.

  Butyrate

D

Which amino acid exhibits a beta-branched side chain?

• A.

  Alanine

• B.

  Leucine

• C.

  Isoleucine

• D.

  Glycine

C

what kind of branch is leucine side chain

gamma branched

In contrast to chemical messengers in classical endocrine signaling systems, chemical messengers in paracrine and autocrine signaling systems are:

• A.

  secreted by neurons only.

• B.

  not likely to bind cell receptors.

• C.

  usually transported by ducts.

• D.

  not transported by blood vessels.

Paracrine and autocrine is local systems so dont need to be far so dont need to use blood vessels answer is D

Which membrane transporter is electrogenic and translocates a net charge across the membrane?

• A.

  Na⁺− H⁺ exchanger

• B.

  Na⁺−Cl^- cotransporter

• C.

  Na⁺−glucose cotransporter

• D.

  GLUT2 facilitative glucose transporter

C

whats Na+-H+ exchanger

antiporter meaning transport of a Na+ coupled with transport of H+ in opposite direction so no net translocation of charge

Whats Na+-Ci-

transport a Na and Cl same direction which cancels each other charge its neutral

Which type of cells have a plasma membrane, lack a nucleus, lack most organelles, and are shaped like a flat disc with a concave center?

• A.

  Erythrocytes

• B.

  Fibroblasts

• C.

  Monocytes

• D.

  Neurons

A

fibroblast

flat, concave center and got nucleus

monocytes

got nucleus, not flat got concave center

neurons

contain all organelles, not flat, nucleated cells

An increase in which of the following physiological variables is most likely to cause an increase in the amount of EPO released by the kidneys in a healthy human adult?

Erythropoietin (EPO) is a glycoprotein hormone that stimulates the production of erythrocytes in red bone marrow. Although EPO is primarily produced and released by the kidneys in response to low tissue levels of oxygen, several other tissues, including the liver and neurons of the central nervous system (CNS), can produce EPO.

• A.

  Amount of aerobic exercise the person performs

• B.

  Total amount of circulating hemoglobin

• C.

  Rate of erythrocyte maturation

  • D.

    Cardiac output (volume of blood pumped by the heart per minute)

A

Expression of the rHuEPO gene in E. coli bacteria produced an EPO protein that did not increase erythrocyte production when injected into humans. The most likely reason for this observation is that:

• A.

  prokaryotic ribosomes interpret the genetic code in a completely different manner than do eukaryotic ribosomes.

• B.

  E. coli cannot glycosylate EPO in the same way that it is glycosylated by eukaryotic cells.

• C.

  bacteria are unable to secrete eukaryotic proteins.

• D.

  only viruses contain the necessary cellular machinery to properly express recombinant proteins.

B

Assume that a certain dominant mutation in the EPO gene exists such that a person who carries this mutant EPO allele has a higher-than-normal number of circulating erythrocytes. Which of the following best describes a mechanism by which this mutation could have its effect?

EPO binds the EPO receptor (EPOR) in erythrocyte precursor cells, causing them to differentiate into mature erythrocytes that are released into circulation

• A.

  The promoter of the mutant EPO allele is defective, and the allele is not transcribed.

• B.

  The mutant EPO allele produces a protein that has an increased affinity for EPOR.

• C.

  The mRNA produced by the mutant EPO allele is degraded before translation can occur.

• D.

  The mutant EPO allele produces a protein that is unable to bind EPOR.

B

glycoprotein limits what

movement, cant cross membrane

In which of the following cellular locations does EPO most likely initially bind EPOR in erythrocyte precursor cells?

EPO is a glycoprotein

• A.

  Cytosol

• B.

  Endoplasmic reticulum

• C.

  Nucleus

• D.

  Plasma membrane

D

Certain types of kidney tumors continuously produce and release EPO. Such tumors most likely have which of the following effects, if any, on erythrocyte production?

Erythropoietin (EPO) is a glycoprotein hormone that stimulates the production of erythrocytes in red bone marrow.

• A.

  The liver will take over the process of regulating erythrocyte production.

• B.

  Erythrocyte production within the bone marrow will cease.

• C.

  Constant stimulation of erythrocyte production will occur within the bone marrow.

• D.

  There is no effect; erythrocyte production will continue to be regulated by the kidneys based on oxygen levels within the body.

C

Selective serotonin reuptake inhibitors (SSRIs) are drugs that can alleviate symptoms of depression by blocking the reuptake of serotonin (5-HT) from the synaptic cleft, thereby increasing the amount of time that 5-HT remains active. Elevated levels of 5-HT within the synapse are associated with feelings of well-being; conversely, low levels of 5-HT are correlated with depressive symptoms.

Recent studies have shown that SSRIs can also mediate their antidepressant effects by increasing brain levels of certain cytokines, including interferon gamma (IFNγ). IFNγ directly induces the expression of the protein p11 in neighboring neurons, which then interacts with 5-HTR4, a 5-HT transmembrane receptor. Figures 1 and 2 provide information about this interaction.

                                                

Figure 1  5-HTR4 protein expression in plasma membrane-enriched fraction (MEM) of hippocampal lysate and in total hippocampal lysate (TOT) from p11 wild-type (WT) or p11 knockout (KO) mice

                                               

Figure 2  Effect of 5-HT on cAMP levels in cells transfected with 5-HTR4 and/or p11

According to the data presented in the passage, 5-HTR4 is a:

• A.

  protein kinase.

• B.

  tyrosine kinase receptor.

• C.

  ligand-gated ion channel.

• D.

  G protein-coupled receptor.

D,its a transmembrane receptor that increased overall cAMP levels a gpcr specialty

whats protein kinase

kinases phosphorylates proteins directly

tyrosine kinase receptor

RTKs autophosphorylate tyrosine resiudes and usually signal via MAPK/Pi3K pathways

5-HT is synthesized from a single amino acid by a short metabolic pathway consisting of a hydroxylation reaction followed by a decarboxylation reaction. The chemical structure of 5-HT is shown.

From which amino acid is 5-HT synthesized?

• A.

  Histidine

• B.

  Proline

• C.

  Tyrosine

  • D.

    Tryptophan

D

In an experiment in which IBU alone was administered to normal mice in order to determine whether long-term treatment with the analgesic can cause behavioral symptoms of depression, what would be the appropriate control group?

• A.

  Normal mice treated with an SSRI

• B.

  Depressed mice treated with IBU

• C.

  Normal mice treated with a placebo

• D.

  Depressed mice treated with cytokines

C

Which comparison best determines whether IFNγ is necessary for antidepressant-induced increases in the expression of p11?

Effect of citalopram and ibuprofen on IFNγ levels in the mouse frontal cortex

                                                     

Expression levels of p11 in:

• A.

  wild-type mice versus IFNγ knockout mice, both treated with p11

• B.

  wild-type mice versus IFNγ knockout mice, both treated with an SSRI

• C.

  wild-type mice treated with IFNγ versus wild-type mice treated with an SSRI

• D.

  wild-type mice treated with IFNγ versus wild-type mice treated with ibuprofen

B, from that figure you can tell that CIT which is an SSRI boosted p11 expression the most and since you wish to test the function of IFNy your test should include it but also have a control where it isn’t at play to compare control to pos test.

Based on information presented in Table 1, which relationship between pH and charged functional groups is accurate?

• Table 1    Biochemical Features of V. cholerae Na⁺-NQR Subunits

  Property	Number of amino acid residues	Molecular weight (kDa)	pI	Number of transmembrane helices
  NqrA	426	47.6	6.30	0
  NqrB	415	47.4	7.16	8
  NqrC	257	28.6	7.30	2
  NqrD	210	22.8	8.50	5
  NqrE	198	20.5	5.35	6
  NqrF	408	47.1	5.25	1

  A.

  At pH 8.50, the ratio of the cationic to anionic functional groups in the NqrD subunit is equal to 1.

• B.

  At pH 7.00, half of the functional groups in the NqrE subunit are protonated.

• C.

  At pH 6.30, the net charge of the cationic and anionic functional groups in the NqrA subunit is equal to 1.

• D.

  At pH 6.00, the majority of the functional groups in the NqrF subunit are protonated.

answer is A

For A, if the ratios are the same, that means the number of cationic functional groups = number of anionic functional groups --> so if we had like 10 cationic functional groups, then we would have 10 anionic function groups, thus the overall charge = 0.

For C, if the net charge is 1, that means we have one more cationic functional group than anionic. This defies the definition of the pI point - the pH at which the overall charge of the amino acid or protein = 0.

What is the most likely effect of adding a sodium ionophore to a culture of V. cholerae?

Cholera is an acute, diarrheal disease caused by infection of the intestine with the gram-negative, motile bacterium Vibrio cholerae. After colonizing the small intestine, V. cholerae secretes cholera toxin (CTX), a protein that ribosylates the Gsα subunit of a G protein, thereby inhibiting its GTPase activity. This causes the dysregulation of a cellular chloride ion channel, resulting in efflux of ions and water from the infected enterocytes into the intestinal lumen.

• A.

  Decreased activity of Na⁺-NQR

• B.

  Decreased production of ATP

• C.

  Decreased pH of the periplasm

• D.

  Decreased consumption of O₂

B

ionophore

compounds that bind to ion and facilitate movement across membrane ionophore collapses sodium gradient decreasing production of ATP

Which two subunits of Na⁺-NQR can be separated by gel filtration but NOT by ion exchange chromatography?

Table 1    Biochemical Features of V. cholerae Na⁺-NQR Subunits

Property	Number of amino acid residues	Molecular weight (kDa)	pI	Number of transmembrane helices
NqrA	426	47.6	6.30	0
NqrB	415	47.4	7.16	8
NqrC	257	28.6	7.30	2
NqrD	210	22.8	8.50	5
NqrE	198	20.5	5.35	6
NqrF	408	47.1	5.25	1

• A.

  NqrA and NqrB

• B.

  NqrC and NqrE

• C.

  NqrD and NqrF

• D.

  NqrE and NqrF

D, the Pi was the same which told us similar ion affinity meaning we must do something else to distinguish them leading to the use of gel filtration, the rest can be filtered with ion exchange as pi are all diff from each other

Which enzyme of the citric acid cycle is NOT directly involved in generation of the dinucleotide required for Na⁺-NQR activity?

In a process similar to proton pumping by Complex I of the electron transport chain, Na⁺-NQR couples the movement of electrons from an NADH donor with ion transport

• A.

  Malate dehydrogenase

• B.

  Succinate dehydrogenase

• C.

  Isocitrate dehydrogenase

• D.

  Α-Ketoglutarate dehydrogenase

We are told that Na+ NQR needs NADH donor reword the question to what doesnt generate NADH which is B

What does succinate dehydrogenase generate

FADH2

What does Malate DH, A ketoglutarate DH, and isocitrate DH produce

NADH

Which biochemical technique requires a pH gradient?

• A.

  Limited proteolysis

• B.

  Southern blotting

• C.

  Isoelectric focusing

• D.

  SDS-PAGE

C

southern blotting

technique to identify specific DNA fragments and doesn’t require pH gradient

SDS PAGE

technique used to separate proteins based on their size and doesn’t require pH gradient

The gene for red-green color blindness is recessive and X-linked. What will be the expected phenotype of the children of a color-blind woman and a man who is not color-blind?

• A.

  All of the children will have normal color vision.

• B.

  All of the daughters will have normal color vision; all the sons will be color-blind.

• C.

  All of the sons will have normal color vision; all the daughters will be color-blind.

• D.

  Half of the daughters will have normal color vision, and half of the daughters will be color-blind; all the sons will be color-blind.

B, we are basically told its an X linked recessive gene meaning only the Mom is affected and can pass on an affected gene to her sons as its recessive meaning will affect the X chromosome in sons

Which type of reaction has a K_eq > 1 and is kinetically fast?

• A.

  Endergonic with high activation energy level

• B.

  Endergonic with low activation energy level

• C.

  Exergonic with high activation energy level

• D.

  Exergonic with low activation energy level

D

Blood glucose levels in a healthy individual as a function of time are shown.

In response to changing glucose levels, which events occur at time points A and B?

• A.

  Hepatocytes secrete glucagon at point A, and the pancreatic alpha cells secrete insulin at point B.

• B.

  Pancreatic alpha cells secrete glucagon at point A, and pancreatic beta cells secrete insulin at point B.

• C.

  Pancreatic alpha cells secrete insulin at point A, and hepatocytes secrete glucagon at point B.

  • D.

    Pancreatic beta cells secrete insulin at point A, and pancreatic alpha cells secrete glucagon at point B.

D

How does the Unit Membrane Model differ from the Fluid Mosaic Model?\

Unit Membrane Model

An extended monomolecular layer of protein coats both the outside of the membrane and the inside of the bilayer, but the protein does not penetrate the bilayer.

Fluid Mosaic Model

The theory that the proteins penetrate the lipid layer is supported when membranes are split along the middle of the lipid layer. When the top half is peeled back, small bumps can be seen on the remaining surface. These are assumed to be proteins.

• A.

  The location of proteins differs in the two models.

• B.

  The Unit Membrane Model has a monomolecular layer of protein on each surface, while the Fluid Mosaic Model has a bimolecular layer of protein on each surface.

• C.

  The Unit Membrane Model has one layer of phospholipids, while the Fluid Mosaic Model has two layers.

• D.

  The Unit Membrane Model contains dissolved protein, while the Fluid Mosaic Model is coated with a monomolecular layer of protein on each surface.

A

Which of the following observations would invalidate the Unit Membrane Model?

Unit Membrane Model

Phospholipid molecules are the most abundant type of lipids in cell membranes. Each consists of a nonpolar, hydrophobic tail, and a polar, hydrophilic head. The phospholipid chains orient themselves to form a bilayer with the tails pointed inward and the hydrophilic heads lined up on both sides of the bilayer. An extended monomolecular layer of protein coats both the outside of the membrane and the inside of the bilayer, but the protein does not penetrate the bilayer.

When thin slices of membranes were examined with an electron microscope, three layers were seen: two electron-dense layers, with one wider layer between them.

It was believed that the electron-dense layers represented proteins, and the lighter area represented lipids.

• A.

  When a thin section of membrane is observed using a microscope at high magnification, two layers of phospholipid heads are observed.

• B.

  Thermodynamic measurements indicate that the phospholipid heads are exposed to water.

• C.

  When a membrane is frozen and then split from surface to surface, proteins are observed within the hydrocarbon chains.

• D.

  Thermodynamic measurements indicate that the phospholipid tails are hidden inside the membrane, away from exposure to water.

C

If the small bumps seen when half of the membrane is peeled away were chemically shown to consist of the lipid cholesterol, how would the Fluid Mosaic Model have to be modified?

• A.

  The proteins would have to be embedded less than halfway through the membrane.

• B.

  There could be no proteins in the membrane.

• C.

  The lipids would have to be embedded in the proteins.

• D.

  It would not necessarily have to be altered, but there would be less evidence supporting it.

D

Which of the following is a weakness in the Unit Membrane Model?

Two theories of membrane structure are discussed below.

Unit Membrane Model

Phospholipid molecules are the most abundant type of lipids in cell membranes. Each consists of a nonpolar, hydrophobic tail, and a polar, hydrophilic head. The phospholipid chains orient themselves to form a bilayer with the tails pointed inward and the hydrophilic heads lined up on both sides of the bilayer. An extended monomolecular layer of protein coats both the outside of the membrane and the inside of the bilayer, but the protein does not penetrate the bilayer.

When thin slices of membranes were examined with an electron microscope, three layers were seen: two electron-dense layers, with one wider layer between them.

It was believed that the electron-dense layers represented proteins, and the lighter area represented lipids.

Fluid Mosaic Model

The structure of the fluid mosaic membrane is a bilayer of phospholipid molecules with proteins inserted into the bilayer. Hydrophilic regions of both the lipids and proteins are found on the outside surface, while the hydrophobic regions of both types of molecules are found on the inside surface. Because lipids are not fixed rigidly in the membrane, the membrane is capable of fluid movement.

The theory that the proteins penetrate the lipid layer is supported when membranes are split along the middle of the lipid layer. When the top half is peeled back, small bumps can be seen on the remaining surface. These are assumed to be proteins.

• A.

  The Unit Membrane Model does not define the cell's size.

• B.

  The Unit Membrane Model does not suggest how the exchange of nutrients and wastes occurs.

• C.

  The Unit Membrane Model does not act as a barrier between the contents of the cell and the cell's external environment.

• D.

  The hydrocarbon bilayer allows passage of polar molecules through the membrane.

Questions asking what does Fluid membrane got that unit doesnt which is B, B wasnt explained for unit membrane model where it was for fluid mosaic model

UCP1 most likely reduces the activity of which enzyme?

UCP1 directly reduces the proton gradient driving oxidative phosphorylation.

• A.

  ATP synthase

• B.

  Pyruvate kinase

• C.

  Na⁺ K⁺ ATPase

• D.

  Succinyl-CoA synthetase

A

The information in the passage best supports which hypothesis?

The number of calories used during physical exercise is greater than the number of calories used for the movements themselves. This may be caused in part by exercise-induced expression of uncoupling protein 1 (UCP1) in subcutaneous fat. Subcutaneous fat is mostly white fat cells but can also contain brown fat cells in mice and humans. As part of a thermogenesis program, UCP1 directly reduces the proton gradient driving oxidative phosphorylation. UCP1 expression is a characteristic of brown fat cells only and is induced by the protein irisin. The data in Table 1 address the relationship between exercise and:

• expression of UCP1 in subcutaneous fat cells,

• expression of FNDC5 (a transmembrane protein in skeletal muscle plasma membranes),

• blood levels of irisin (a soluble protein formed by cleaving the extracellular domain of FNDC5), and

• expression of adiponectin (a hormone produced by white fat cells)

in both wild-type mice and mice with overexpression of skeletal muscle PGC-1α (a transcription factor whose expression in skeletal muscle is induced by exercise).

Table 1

Effects of Exercise and PGC-1α on UCP1, FNDC5, Irisin, and Adiponectin

Experimental conditions		UCP1 mRNA levels	FNDC5 mRNA levels	Blood irisin levels	Adiponectin mRNA levels
Wild-type mice	no endurance exercise	1	1	1	1
	endurance exercise	25	2.8	1.7	0.5
Mice with skeletal muscle PGC-1α overexpression	no endurance exercise	2.5	80	nd	0.8
Note: nd = not determined; all measurements are relative to control.

• A.

  Exercise prevents glucose uptake.

• B.

  Exercise promotes less effective cellular respiration.

• C.

  Exocrine secretions of skeletal muscle act on adipose tissue.

  • D.

    Endocrine secretions of adipose tissue act on skeletal muscle.

B, ucp1 levels increased which lowered oxidative phosphorylation used to make ATP ruining cellular respiration

Mice that overexpress PGC-1α specifically in their skeletal muscles are most likely to exhibit which phenotype relative to wild-type mice?

The number of calories used during physical exercise is greater than the number of calories used for the movements themselves. This may be caused in part by exercise-induced expression of uncoupling protein 1 (UCP1) in subcutaneous fat. Subcutaneous fat is mostly white fat cells but can also contain brown fat cells in mice and humans. As part of a thermogenesis program, UCP1 directly reduces the proton gradient driving oxidative phosphorylation. UCP1 expression is a characteristic of brown fat cells only and is induced by the protein irisin. The data in Table 1 address the relationship between exercise and:

• expression of UCP1 in subcutaneous fat cells,

• expression of FNDC5 (a transmembrane protein in skeletal muscle plasma membranes),

• blood levels of irisin (a soluble protein formed by cleaving the extracellular domain of FNDC5), and

• expression of adiponectin (a hormone produced by white fat cells)

in both wild-type mice and mice with overexpression of skeletal muscle PGC-1α (a transcription factor whose expression in skeletal muscle is induced by exercise).

Table 1

Effects of Exercise and PGC-1α on UCP1, FNDC5, Irisin, and Adiponectin

Experimental conditions		UCP1 mRNA levels	FNDC5 mRNA levels	Blood irisin levels	Adiponectin mRNA levels
Wild-type mice	no endurance exercise	1	1	1	1
	endurance exercise	25	2.8	1.7	0.5
Mice with skeletal muscle PGC-1α overexpression	no endurance exercise	2.5	80	nd	0.8
Note: nd = not determined; all measurements are relative to control.

• A.

  Lower body weight

• B.

  Lower body temperature

• C.

  Higher physical activity

• D.

  Higher nonfasting blood glucose levels

A, need to connect alot of stuff so PGC-1a mice got higher levels of FNDC5 which is linked to irisin which is linked to expression of UCP1 which casues an increase of energy use lowering body weight

Which outcome most likely results from exposure of Ogg1^-/- mice to TNFα

Upon exposure to pro-inflammatory agents such as TNFα, cells produce reactive oxygen species (ROS), which can react with guanine bases in DNA to generate 8-oxo-G. This modified guanine can participate in Hoogsteen base pairs with adenine, an event that upon DNA replication results in G to T and C to A mutations. Guanine-rich promoter regions are particularly susceptible to this type of ROS-induced DNA damage.

OGG1 is a DNA glycosylase that recognizes 8-oxo-G. OGG1 is involved in two processes: base excision repair of 8-oxo-G as well as transcription initiation for pro-inflammatory genes such as Cxcl family members. These transcription events also involve binding of NF-κB to promoters as NF-κB recruitment increases dramatically following OGG1 binding to DNA.

• A.

  Increase in cancer incidence

• B.

  Increase in Cxcl2 expression

• C.

  Decrease in cellular ROS levels

• D.

  Decrease in K_D of TH5487 for its target

First we are told its OOG1 knockout aka doesnt do what OOG1 is suppose to, OGG1 got two function first is to repair 8 oxo G which is modified guanine that leads to mutation aka CANCER OR DISEASE so if we were to remove OOG1 that fixes this cancerous mutation we are increasing cancer, so answer is A

TH5487 acts as which type of inhibitor?

TH5487 is a compound that mimics 8-oxo-G structure and binds to the active site of OGG1

• A.

  Competitive

• B.

  Mixed

• C.

  Noncompetitive

• D.

  Uncompetitive

A

Figure 2

Cxcl1 expression levels for wild-type and Ogg1–/– mice in the presence (+) and absence (–) of TNFα and TH5487

Based on data shown in Figure 2, what are the effects of OGG1 and TH5487 on Cxcl1 expression?

1. OGG1 reduces the TNFα induced Cxcl1 expression.

2. OGG1 stimulates the TNFα induced Cxcl1 expression.

3. TH5487 reduces the OGG1-mediated Cxcl1 expression.

4. TH5487 stimulates the OGG1-mediated Cxcl1 expression.

• A.

  I and III only

• B.

  I and IV only

• C.

  II and III only

• D.

  II and IV only

C

Researchers measured the NF- κB occupancy of the Cxcl2 promoter following exposure to TNFα both in the presence and absence of TH5487. Based on the data presented in the passage, which figure depicts the expected results?

Figure 2

Cxcl1 expression levels for wild-type and Ogg1–/– mice in the presence (+) and absence (–) of TNFα and TH5487

• A.

  

• B.

  

• C.

  

• D.

  

Using results of figure 2 we can tell that TNFa stimulates production of CXC1 expression of wild type and TH5487 inhibits produce when active just apply the same scheme to the question bc its about cxcl kinda so answer is C

Which Roman numeral represents the CNS integration for a pain reflex arc?

• A.

  I

• B.

  II

• C.

  III

• D.

  IV

B

The resting potential of a neuron is primarily a result of the:

• A.

  release of neurotransmitters from the axon.

• B.

  distribution of ions across the plasma cell membrane.

• C.

  action of neurotransmitters on the postsynaptic receptor.

• D.

  active transport of Ca²⁺ ions across the plasma cell membrane.

B

Contraction of the diaphragm results in:

• A.

  decreased intrathoracic pressure and inhalation.

• B.

  decreased intrathoracic pressure and exhalation.

• C.

  increased intrathoracic pressure and inhalation.

• D.

  increased intrathoracic pressure and exhalation.

A

relaxation of diaphragm would be

increased intrathoracic pressure and exhalation

In an enzyme-catalyzed reaction where enzyme concentration is held constant and substrate concentration is relatively low, which kinetic parameter will increase with the addition of more substrate?

(Note: Other than substrate concentration, assume no other changes to reaction conditions.)

• A.

  K_M

• B.

  k_cat

• C.

  V_max

• D.

  V₀

D

what does change in enzyme affect

Vo

Vmax

Km

Kcat

Vo increases

Vmax increases bc its proportional to enzyme

Km and Kcat is unchanged

competitive does what

km increases v max same

noncompetitive effects

vmax decreases km stays same

uncompetitive effects

vmax and km both decreases

These experiments suggest that the mutant RB proteins do not:

Figure 1  Change in percentage of cells in G₁ after transfection with RB and after transfection with RB and E7. Note that a high number of cells in G₁ suggests that arrest has occurred. Change after transfection with wild-type RB is arbitrarily set at 100% in this analysis. (WT = wild-type; other abbreviations designate the three different mutant RB proteins.)

• A.

  bind to E7.

• B.

  bind to E2F.

• C.

  arrest cells in G₁.

  • D.

    permit exit from G₁.

A

The retinoblastoma protein (RB) suppresses human cell division by arresting cells in the G₁ phase of the cell cycle and preventing progression to the next phase. It accomplishes this task by binding to another protein, E2F, a transcription factor needed for further progression through the cell cycle.

If the RB mutants cannot bind to E2F, then:

• A.

  cell division arrest will not occur.

• B.

  E7 will not bind to these mutants.

• C.

  CDK4 cannot phosphorylate these mutants.

• D.

  E2F will bind to E7.

A

Figure 2  Percentage of cells in G₁ after transfection with RB and after transfection with RB and CDK4 (WT = wild-type; other abbreviations designate the three different mutant RB proteins.)

Comparing the bars for RB transfection with those of RB and CDK4 transfection in Figure 2 shows that:

• A.

  mutant RB is better at arresting cells in G₁ than wild-type RB.

• B.

  CDK4 transfection causes more mutant RB to be phosphorylated.

• C.

  more cells are G₁ arrested in CDK4-transfected cells.

• D.

  CDK4 transfection results in fewer cells being G₁ arrested.

Solution: The correct answer is D.

D

The LXCXE motif is described as being "highly conserved." Certain parts of the genome, such as that encoding the LXCXE motif, are highly conserved because they are:

Many viruses can induce abnormal exit from G₁ using viral proteins that bind to RB at a motif at the N-terminal called LXCXE. An example is the E7 papilloma protein, which causes the excessive proliferation of cells in warts.

The site at which LXCXE proteins bind is called the pocket domain and is highly conserved on RB and related proteins in plants and animals. The configuration of the pocket domain is well established. Mutant experimental RB proteins are available with alterations in the conserved amino acids of the pocket domain.

• A.

  vital to an organism's survival.

• B.

  chemically incapable of mutation.

• C.

  stored in vesicles for later secretion.

• D.

  stored in cell compartments where they are unlikely to be secreted.

A, just used context clue, was told LXCXE is highly conserved meaning honestly its vital to the organism to live otherwise why conserve it yk

Based on the information in the passage, the mutation that causes the LP phenotype is most likely located in:

Lactose intolerance, also known as lactase deficiency, is a condition that results from insufficient synthesis of the enzyme lactase, which converts lactose into glucose and galactose. Although all healthy newborns produce sufficient levels of lactase, two distinct phenotypes exist in adults: lactase persistence (LP) (includes heterozygotes) and lactase non-persistence (LNP). LP adults continue to produce lactase into adulthood, whereas LNP individuals do not. It has been suggested that the LP phenotype is the result of a mutation event that coincided with the domestication of dairy animals thousands of years ago in areas such as northwestern Europe and within some Afro-Arabian nomadic populations. In Northwestern Europeans, sets of alleles located closely together on the same chromosome (haplotypes) associated with the LP phenotype contain several single nucleotide polymorphisms (SNPs). However, only one appears to be directly responsible for this phenotype; the others are silent. By comparison, several different SNPs appear to be directly responsible for the LP phenotype in Afro-Arabian LP-associated haplotypes.

• A.

  an intron within the lactase gene.

• B.

  the coding sequence of the lactase gene.

• C.

  an enhancer sequence of the lactase gene.

• D.

  the stop codon at the end of the lactase gene.

C, we are told those with LP will continue lactating in adulthood meaning the gene can’t be turned on its always active which best fit with enhancer, the promoting sequence is mutated unable to turn off

Lactase can be classified as which type of enzyme?

Lactose intolerance, also known as lactase deficiency, is a condition that results from insufficient synthesis of the enzyme lactase, which converts lactose into glucose and galactose

• A.

  Isomerase

• B.

  Hydrolase

• C.

  Transferase

• D.

  Oxidoreductase

B, the glycosidic linkages between lactose is broken down via hydrolysis to form glucose and galactose

Which cells express lactase?

• A.

  Enterocytes of the duodenal villi

• B.

  Epithelial cells of the colon lining

• C.

  Parietal cells of the stomach lining

• D.

  Bile-producing hepatocytes of the liver

A, enterocytes produces enzymes like lactase

One of the silent SNPs present in the Northwestern European haplotype that is associated with LP resides within the lactase gene. Genomic DNA and cDNA of the region containing this SNP in an LP heterozygous adult was sequenced. The sequence results are shown.

The SNP resulted from what type of mutation?

• A.

  Purine to purine

• B.

  Purine to pyrimidine

• C.

  Pyrimidine to purine

• D.

  Pyrimidine to pyrimidine

Question wasn’t asking difference between genomic DNA and cDNA, the mutation only occured in genomic DNA theres a band for both C and T thats the mutation you cannot have two nucleotide in the same row the mutation was about C and T which are pyrimidines so answer is D

Purines

A and G

pyramidines

C and T and U(RNA)

Consider an experiment that consists of two ionic solutions separated by a membrane that contains a ligand-gated potassium channel. The lack of current generation in response to addition of ligand is explained by:

1. lack of potassium in either solution.

2. the presence of potassium in only one solution.

3. equal concentrations of potassium in the two solutions.

• A.

  I only

• B.

  I and II only

• C.

  I and III only

• D.

  II and III only

Lack of current indicates that a side is missing an ion or that its equal meaning no movement at all aka no current so answer choice C is right

Which molecule is NOT formed during the steps of glycolysis?

• A.

  Fructose 6-phosphate

• B.

  Oxaloacetate

• C.

  Pyruvate

• D.

  2-Phosphoglycerate

B, oaa is formed in citric acid cycle

A particular diploid organism is heterozygous in each of 3 unlinked genes. Considering only these 3 genes, how many different types of gametes can this organism produce?

• A.

  3

• B.

  4

• C.

  6

• D.

  8

2³= 8