1/4
Looks like no tags are added yet.
Name | Mastery | Learn | Test | Matching | Spaced | Call with Kai |
|---|
No analytics yet
Send a link to your students to track their progress
In a DNA sample we collected from a flower, we find that 34% of the nitrogenous bases in this organisms DNA is made up of nucleotides that contain the nitrogenous base Guanine (G). Based on what you just learned about base pairing rules, predict what proportion of nucleotides in the genome of this flower contain the nitrogenous base Adenine (A).
16%
What is the Central Dogma of Biology?
DNA --> RNA --> Protein
What is a gene?
A gene is a stretch of DNA that codes for a protein
Give the mRNA transcript
AUGUACACAGCAAUCUCCGGAAGGGAGGCGACG
What is the deciphered sentence?
MYTAISGREAT