Real stuff to know from AAMC - BB

Simple Squamous

Where:

• Alveoli (lungs)

• Capillaries

• Bowman's capsule

Why: Thin → diffusion

If you see:

• Gas exchange

• Oxygen diffusion

• Filtration

Pick simple squamous.

Simple Cuboidal

Where:

• Kidney tubules

• Small glands

Why: Secretion + absorption

If you see:

• Kidney reabsorption

• Small ducts

Think cuboidal.

Simple Columnar

Where:

• Small intestine

• Stomach

• Uterus

Why: Absorption + secretion

If you see:

• Nutrient absorption

• Microvilli

• Digestive enzymes

Think columnar.

Pseudostratified Ciliated Columnar

Where:

• Upper respiratory tract (trachea, bronchi)

Why: Moves mucus

If you see:

• Cilia

• Respiratory tract

• Clearing particles

Think pseudostratified.

Stratified Squamous

Where:

• Skin

• Mouth

• Esophagus

Why: Protection from friction

If you see:

• Abrasion

• Mechanical stress

• Protection

Think stratified squamous.

Transitional

Where:

• Bladder

That’s basically it.

If you see stretching in urinary system → transitional.

Order of sperm development in seminiferous tubules (outside → inside)

1. Spermatogonia (stem cells)

2. Spermatocytes (meiosis)

3. Spermatids

4. Spermatozoa

Mnemonic:
Go Create Tiny Zebras

(Gonia → Cytes → Tids → Zoids)

what is a zymogen

an inactive enzyme precursor that requires a biochemical change—typically the cleavage of peptide bonds—to become an active enzyme

What is the difference between heterochromatin and euchromatin?

Euchromatin

• Loosely packed DNA

• Transcriptionally active (genes are being expressed)

• RNA polymerase can access the DNA

Heterochromatin

• Tightly packed DNA

• Transcriptionally inactive (genes mostly silenced)

• DNA is not easily accessible

Mnemonic:
EU = Expressed / Easy to read
HETERO = Hidden

What are the main differences between prokaryotes and eukaryotes, and which organisms belong to each group?

Prokaryotes

• No nucleus

• No membrane-bound organelles

• Smaller and simpler cells

• DNA in nucleoid region

Examples

• Bacteria

• Archaea

---

Eukaryotes

• Have a nucleus

• Have membrane-bound organelles (mitochondria, ER, Golgi)

• Larger and more complex cells

Examples

• Animals

• Plants

• Fungi

• Protists (ex: Plasmodium falciparum)

---

Shared by BOTH

• Plasma membrane

• Cytoplasm

• DNA

• Ribosomes

---

Mnemonic

Pro = Primitive (simple, no nucleus)
Eu = True nucleus

restriction enzymes locate:

Palindromes!

What are the key roles of cholesterol?

• Regulates membrane fluidity (buffers against temperature changes)

• Stabilizes membranes by fitting between phospholipids

• Forms lipid rafts with sphingolipids for cell signaling

• Precursor to steroid hormones, bile acids, and vitamin D

If a question says capillary + exchange, think:

endothelial cells

Glucocorticoids (like cortisol):

• Increase gluconeogenesis in the liver → make glucose from noncarbohydrate sources.

• Mobilize amino acids from muscle → this is essentially protein degradation.

• Increase lipolysis → mobilize fats for energy.

see back

made ya look

What are the three germ layers, where do they originate, and what do they form?

What is immunohistochemistry (IHC) and how is it used?

Definition:

• Detects specific proteins in tissue samples using antibodies.

How it works:

1. Tissue slice is prepared and fixed on a slide

2. Primary antibody binds the target protein

3. Secondary antibody (optional) carries a label (color, enzyme, or fluorescent)

4. Label shows where the protein is located in the tissue

Uses:

• Identify protein expression in cells

• Diagnose cancers

• Research cellular localization of proteins

MCAT shortcut:

“IHC = antibodies + tissue → color shows protein location”

What is aldosterone, and what does it do?

Back (Answer / Explanation)

Source:

• Adrenal cortex (zona glomerulosa)

Target:

• Kidney distal tubules & collecting ducts

Actions:

• Increases Na⁺ reabsorption → water follows → ↑ blood volume & blood pressure

• Increases K⁺ excretion → lowers blood potassium

Mechanism:

• Binds receptors → ↑ transcription of Na⁺ channels (ENaC) & Na⁺/K⁺ ATPase

MCAT Shortcut:

“Aldosterone saves Na⁺, spits out K⁺ → raises blood pressure.”

pentose phosphate pathway

axon anatomy and function

what do each of the enzyme values mean?

A macrophage becomes a ____ when a particle is injested

phagosome

Allosteric Regulation

• Definition: Regulation of an enzyme’s activity by a molecule binding to a site other than the active site (allosteric site).

• Effect: Binding changes the enzyme’s shape, altering activity:

  • Activator: increases enzyme activity

  • Inhibitor: decreases enzyme activity

• Key MCAT points:

  • Different from competitive inhibition (allosteric = other site; competitive = active site)

  • Often used in feedback inhibition in metabolic pathways

• Memory trick: “Allosteric = ‘other site’ button that turns the enzyme up or down”

PI

low = acidic

high = basic

ubiquitation means:

marks the thing for degradation

What is the primary function of Pancreatic DUCTS?

Membrane Proteins – Types, Structure, and Key Features

Transmembrane (Integral) Proteins

• Definition: Proteins that span the lipid bilayer one or more times

• Structure:

  • Made of α-helices (common) or β-barrels (bacteria)

  • Multi-pass proteins weave in and out of the membrane

  • Loops alternate sides: extracellular ↔ cytoplasmic

  • N-terminus orientation determines first side:

    • If N-term is cytoplasmic → first loop outside = extracellular

    • Every helix flips side → after 12 helices, cytoplasmic C-term if specified

• Functions: Transport, signaling, receptors

• Examples: Glut5 (12-pass), GPCRs, K⁺ channels

Memory trick: “N-term tells you the start; each helix flips sides”

---

2. Lipid-Anchored Proteins

• Definition: Covalently attached to a lipid in the membrane, do not span

• Structure: Protein anchored via fatty acids, prenyl groups, or GPI anchors

• Functions: Signaling, membrane localization

• Examples: Ras, GPI-linked proteins

Memory trick: “Anchored = tethered, not woven”

---

3. Peripheral Proteins

• Definition: Loosely bound to membrane surface via interactions with lipids or transmembrane proteins

• Structure: No membrane-spanning regions

• Functions: Cytoskeleton attachment, signaling, enzymatic activity

• Examples: Spectrin, some kinases

Memory trick: “Peripheral = surface, removable”

---

4. Channel & Carrier Proteins (Functional Subtypes of Transmembrane Proteins)

• Channel Proteins: Pores → passive ion/molecule transport

• Carrier Proteins: Bind substrate → conformational change → transport molecules

• Examples: Aquaporins (channel), GLUT transporters (carrier)

ATGCTCCAGTTCCTGCTTGGA

ATP synthase is located

inner membrane of mitochrondria

(aorta)