Transcription & Translation

mRNA

An RNA molecule that carries genetic instructions from the nucleus to the ribosome to synthesize proteins

Transcription

First step in the process of using DNA to build proteins - MAKES mRNA

Ribosomes

The sites of translation — helps link amino acids into polypeptide chains

Translation

The cell translates the nucleotide sequence of an mRNA into the amino acid sequence of a polypeptide (AGCT)

Primary RNA

The initial RNA transcript from any gene including RNA not translated into protein(ex: tRNA/ rRna) is the primary RNA

Template Strand

Runs in a 3’ to 5’ direction & read by RNA polymerase to provide.a copy of the nucleotides in the RNA transcript

Transcription & Translation in Bacteria

Lack of membranes and compartmentalization allows translation of mRNA while transcription is happening.

Transcription & Translation in Eukaryotes

RNA is made in the nucleus, but the mNA is transported to the cytoplasm for translation. There’s also RNA processing.

Coding/Nontemplate Strand

The strand not used during transcription

Compare the direction of mRNA, template strand, and nontemplate

The mRNA molecule is reverse complementary to the template and then identical to the coding strand except U instead of T

Transcription Steps

1. RNA polymerase: Attaches to a segment of DNA (a gene) and pries the two strands of DNA apart to join together RNA complementary to the DNA strands

   1. Initiation: RNA polymerase binds to the promoter, the DNA strands unwind, and the polymerase initiates RNA synthesis at the start of the template strand. Uses

   2. Elongation: The polymerase moves down, unwinding DNA and elongating the transcript 5’--> 3’. DNA strands simultaneously tried to reform the double helix so only a little bit is exposed at a time

   3. Termination: RNA transcript releases and polymerase detaches from DNA when it reaches the terminator sequence

Promoter

The DNA sequence where RNA polymerase attaches and initiates transcription — tells RNA polymerase which strand is coding vs. template

Terminator

The DNA sequence that signals the end of transcription

Transcription Factors

a group of proteins that helps RNA polymerase bind to the promoter by recognizing the promoter

Transcription Initiation Complex

The whole complex of transcription factors and RNA polymerase II bound to the promoter

RNA processing

Both ends of primary transcripts are altered (happens during and immediately after transcription

5’ cap

A modified form of guanine added onto the 5 end after the first 20-40 nucleotides have been transcribed

What is the purpose of the poly-A-tail

The poly-A-tail is an extra 50-250 more adenine added at the end of the 3’ end and it protects the RNA from enzyme degradation

RNA splicing

The process where introns are removed and exons are reconnected

Introns

Noncoding sequneces that are removed during RNA processing

Exon

Coding sequences kept in mature mRNA

During transcription, one strand of the double stranded DNA molecule serves as the template strand for RNA polymerase. If the template strand (of DNA) sequence is 5'-acgattgatggtgtgaagcat-3', the coding strand (of DNA) sequence should be 5'- _______________________-3'.

 

tgctaactaccacacattcgta

The coding and template strands are complementary and antiparallel

During transcription, one strand of the double stranded DNA molecule serves as the template strand for RNA polymerase. If the template strand sequence is 5'-acgattgatggtgtgaagcat-3', the mRNA sequence should be 5'- _______________________-3'.

 

ugcuaacuaccacacauucgua

During transcription, one strand of the double stranded DNA molecule serves as the template strand for RNA polymerase. If the template strand sequence is 5'-acgattgatggtgtgaagcat-3', the mRNA sequence should be 5'- _______________________-3'.

augcuucacaccaucaaucgu

During transcription, one strand of the double stranded DNA molecule serves as the template strand for RNA polymerase. If the template strand sequence is 5'-acgattgatggtgtgaagcat-3', the protein sequence should be _______________________. (Use 1-letter code amino acid)

MLHTINR

During transcription, one strand of the double stranded DNA molecule serves as the template strand for RNA polymerase. If the template strand sequence is 5'-acgattgatggtgtgaagcat-3', the 1st tRNA brought to ribosome during translation should have an anticodon sequence of 5'-________-3'.

CAU

Transcription occurs along the template strand in a ____ direction forming a mRNA molecule in the ____ direction.

Group of answer choices

none of the other choices

3' to 5'; 3' to 5'

3' to 5'; 5' to 3'

5' to 3'; 5' to 3'

5' to 3'; 3' to 5'

Transcription goes along the template strand in a 3’ to 5’ direction and forms mRNA 5’ to 3’

Which of the following molecules are reverse complementary to the mRNA?

I. the template strand of the DNA

II. the coding strand of the DNA

III. the anticodon of the tRNA

IV. the ribosomal RNA

III and I

5’ UTR

Tells the ribosome where they can begin transcription

Similar to how the promoter tells the RNA polymerase where to start

3’ UTR

Regulates mRNA after transcription

mRNA(messenger RNA)

An RNA molecule located in the nucleus  that carries genetic instructions from the nucleus to the ribosome to synthesize proteins

premRNA

The original RNA transcript before RNA processing for eukaryotes, located in the nucleus

Ribosome

The sites of translation — helps link amino acids into polypeptide chains

Compare the direction of template strand vs. mRNA

The template strand is reverse complementary to the mRNA

Compare the direction of template strand vs. coding Strand

The coding and template strands are antiparallel complementary

spliceosome

A complex of proteins and small RNAs that remove of introns

What does P site carry?

 Holds tRNA carrying polypeptide chains

What does A site carry?

 Holds tRNA carrying the next amino acid to be added to the chain (‘A= Almost)

what does E site carry?

Where discharged tRNAs leave (E  = EXIT)

What’s the purpose of tRNA?

Brings the correct amino acid to the ribosome during translation.

What’s the purpose of rRNA

builds the ribosome and catalyzes peptide bonds

What is the role of RNA polymerase in transcription?

RNA polymerase attaches to a gene, unwinds the DNA, and synthesizes RNA complementary to the template strand.

What happens during transcription initiation?

RNA polymerase binds to the promoter, DNA unwinds, and RNA synthesis starts at the beginning of the template strand.

What direction does RNA polymerase elongate the RNA transcript?

5′ → 3′

What happens during transcription elongation?

RNA polymerase moves along DNA, unwinding it and adding nucleotides to the RNA transcript, while the DNA rewinds behind it.

What happens during transcription termination?

RNA polymerase reaches the terminator sequence, releases the RNA transcript, and detaches from DNA.

Why is only a small section of DNA unwound at a time during elongation?

Because DNA strands try to reform the double helix, so only a short segment is exposed for transcription.