N17 Biology SL Paper 1

5.0(1)
studied byStudied by 19 people
5.0(1)
full-widthCall Kai
learnLearn
examPractice Test
spaced repetitionSpaced Repetition
heart puzzleMatch
flashcardsFlashcards
GameKnowt Play
Card Sorting

1/29

flashcard set

Earn XP

Description and Tags

Questions and answers, taken directly from the markscheme.

Study Analytics
Name
Mastery
Learn
Test
Matching
Spaced

No study sessions yet.

30 Terms

1
New cards
Which function is accomplished by structures X and Y in the *Paramecium*?
Which function is accomplished by structures X and Y in the *Paramecium*?
X = homeostasis

Y = feeding
2
New cards
Which evidence from the image of *Paramecium* indicates whether the organism is a prokaryote or a eukaryote?
Compartments in the cell indicate that it is a eukaryote
3
New cards
The salt concentration inside an animal cell is 1.8%. The salt concentration in the surrounding medium becomes 5%. What will be the likely response?
The cell will shrink from loss of water
4
New cards
In the diagram, which structure is an intrinsic or integral protein?
In the diagram, which structure is an intrinsic or integral protein?
B
5
New cards
In the diagram, which part of the membrane structure does the molecule below form?
In the diagram, which part of the membrane structure does the molecule below form?
A
6
New cards
Which molecule could be hydrolyzed into amino acids?
Which molecule could be hydrolyzed into amino acids?
C
C
7
New cards
Which property of water accounts for its moderating effects on the Earth’s atmosphere?
Thermal
8
New cards
The Framingham heart study was an observational study that went on for 20 years. The following data was produced.

Which conclusion can be drawn, based on these data?
The Framingham heart study was an observational study that went on for 20 years. The following data was produced.

Which conclusion can be drawn, based on these data?
The more margarine consumed, the greater the incidence of coronary heart disease.
9
New cards
Three flasks were prepared for an analsysi of the activity of amylase. At time zero, each of the substances indicated in the diagram was added.

Which flasks could provide support for the hypothesis that heat denatures enzymes?
Three flasks were prepared for an analsysi of the activity of amylase. At time zero, each of the substances indicated in the diagram was added.

Which flasks could provide support for the hypothesis that heat denatures enzymes?
Flasks I and III after 15 minutes
10
New cards
For which discovery about DNA do Watson and Crick receive credit?
The shape of DNA is a double helix
11
New cards
Which sequence of bases and amino acids could be produced by transcription and translation of the DNA molecule shown?
Which sequence of bases and amino acids could be produced by transcription and translation of the DNA molecule shown?
Sequence of bases: UAC-UUU-ACG-AAA-GCG-CCC

Sequence of amino acids: Tyr-Phe-Thr-Lys-Ala-Pro
12
New cards
Which process causes ADP to change to ATP?
Anaerobic cell respiration
13
New cards
What occurs during meiosis but not mitosis?
Homologous chromosomes pair up
14
New cards
Which diagram(s) represent(s) processes used in asexual reproduction?
Which diagram(s) represent(s) processes used in asexual reproduction?
II only
15
New cards
*Hind*III is an endonuclease that recognizes the sequence AAGCTT, cutting between the two adenines.

\
5’TTAAGCTTAAGAAGAAGCTT3’

3’AATTCGAATTCTTCTTCGAA5’

\
Into how many DNA fragments would the strand shown be cut by *Hind*III?
3
16
New cards
An allele for lactase persistence allows humans to digest milk as adults. People who lack this allele are lactose intolerant in adulthood.

What is the pattern of inheritance?
An allele for lactase persistence allows humans to digest milk as adults. People who lack this allele are lactose intolerant in adulthood.

What is the pattern of inheritance?
Lactase persistence is autosomal dominant.
17
New cards
In an area of forest measuring 100 m by 100 m, samples were taken to estimate the number of silver maple (*Acer saccharinum*) trees in the forest. The number of trees counted in each of five areas of 400 m^2 was recorded.

Approximately how many silver maple trees are in the 10 000 m^2 area of forest?
In an area of forest measuring 100 m by 100 m, samples were taken to estimate the number of silver maple (*Acer saccharinum*) trees in the forest. The number of trees counted in each of five areas of 400 m^2 was recorded.

Approximately how many silver maple trees are in the 10 000 m^2 area of forest?
125
18
New cards
The diagram shows the carbon cycle. 

Which two processes correspond to the labelled arrows?
The diagram shows the carbon cycle.

Which two processes correspond to the labelled arrows?
J is combustion and K is respiration
19
New cards
An experiment was set up so that each test tube contained water at a pH of 6.3 and a pH indicator. Test tubes 1 and 2 also contained a common pond autotroph. Carbon dioxide dissolves in water and forms carbonic acid. After three days the four test tubes were found to have these results.

What conclusion can be drawn from test tube 1 and test tube 2?
An experiment was set up so that each test tube contained water at a pH of 6.3 and a pH indicator. Test tubes 1 and 2 also contained a common pond autotroph. Carbon dioxide dissolves in water and forms carbonic acid. After three days the four test tubes were found to have these results.

What conclusion can be drawn from test tube 1 and test tube 2?
Test tube 1: Photosynthesis has used CO2

Test tube 2: Respiration has produced CO2
20
New cards
Which of these structures is **not** homologous?
Which of these structures is **not** homologous?
C
21
New cards
What causes variation within a population
Fertilization and mutation
22
New cards
Which of the organisms A-D, identified by the key, represents a reptile?
Which of the organisms A-D, identified by the key, represents a reptile?
B
23
New cards
The table shows the number of differences between humans and other selected organisms for the protein cytochrome c oxidase. This protein, consisting of 104 amino acids, is located in the mitochondria and functions as an enzyme during cell respiration. 

If the data were used to draw a cladogram, which chordates would be furthest apart from humans?
The table shows the number of differences between humans and other selected organisms for the protein cytochrome c oxidase. This protein, consisting of 104 amino acids, is located in the mitochondria and functions as an enzyme during cell respiration.

If the data were used to draw a cladogram, which chordates would be furthest apart from humans?
Tuna fish because it is the chordate with the most differences
24
New cards
Dialysis membrane was set up to model digestion and absorption in the small intestine. 

What is a limitation of this model?
Dialysis membrane was set up to model digestion and absorption in the small intestine.

What is a limitation of this model?
There can be no active transport.
25
New cards
The diagram shows red blood cells and undifferentiated tissue cells.

Diffusion of oxygen from blood cells to tissue cells is represented by arrow 3 in the diagram. What molecules are shown diffusing by arrow 1 and arrow 2.
The diagram shows red blood cells and undifferentiated tissue cells.

Diffusion of oxygen from blood cells to tissue cells is represented by arrow 3 in the diagram. What molecules are shown diffusing by arrow 1 and arrow 2.
Arrow 1: glucose

Arrow 2: carbon dioxide
26
New cards
What is a characteristic of antigens?
They stimulate the production of antibodies
27
New cards
What can protect the body from blood loss?
Fibrin
28
New cards
Which structure in the motor neuron is required for saltatory conduction?
Which structure in the motor neuron is required for saltatory conduction?
C
29
New cards
Which hormone inhibits appetite?
Leptin
30
New cards
What is the name and source of the hormone that regulates basal metabolic rate?
Name: thyroxin

Source: thyroid gland

Explore top flashcards

Lecture 16 Terms
Updated 1136d ago
flashcards Flashcards (21)
Other Senses
Updated 1008d ago
flashcards Flashcards (25)
2017/2018
Updated 729d ago
flashcards Flashcards (47)
A1
Updated 8d ago
flashcards Flashcards (285)
Lecture 16 Terms
Updated 1136d ago
flashcards Flashcards (21)
Other Senses
Updated 1008d ago
flashcards Flashcards (25)
2017/2018
Updated 729d ago
flashcards Flashcards (47)
A1
Updated 8d ago
flashcards Flashcards (285)