N17 Biology SL Paper 1

Questions and answers, taken directly from the markscheme.

Which function is accomplished by structures X and Y in the Paramecium?

Which function is accomplished by structures X and Y in the Paramecium?

X = homeostasis

Y = feeding

Which evidence from the image of Paramecium indicates whether the organism is a prokaryote or a eukaryote?

Compartments in the cell indicate that it is a eukaryote

The salt concentration inside an animal cell is 1.8%. The salt concentration in the surrounding medium becomes 5%. What will be the likely response?

The cell will shrink from loss of water

In the diagram, which structure is an intrinsic or integral protein?

B

In the diagram, which part of the membrane structure does the molecule below form?

A

Which molecule could be hydrolyzed into amino acids?

C

Which property of water accounts for its moderating effects on the Earth’s atmosphere?

Thermal

The Framingham heart study was an observational study that went on for 20 years. The following data was produced.

Which conclusion can be drawn, based on these data?

The more margarine consumed, the greater the incidence of coronary heart disease.

Three flasks were prepared for an analsysi of the activity of amylase. At time zero, each of the substances indicated in the diagram was added.

Which flasks could provide support for the hypothesis that heat denatures enzymes?

Flasks I and III after 15 minutes

For which discovery about DNA do Watson and Crick receive credit?

The shape of DNA is a double helix

Which sequence of bases and amino acids could be produced by transcription and translation of the DNA molecule shown?

Sequence of bases: UAC-UUU-ACG-AAA-GCG-CCC

Sequence of amino acids: Tyr-Phe-Thr-Lys-Ala-Pro

Which process causes ADP to change to ATP?

Anaerobic cell respiration

What occurs during meiosis but not mitosis?

Homologous chromosomes pair up

Which diagram(s) represent(s) processes used in asexual reproduction?

II only

HindIII is an endonuclease that recognizes the sequence AAGCTT, cutting between the two adenines.

5’TTAAGCTTAAGAAGAAGCTT3’

3’AATTCGAATTCTTCTTCGAA5’

Into how many DNA fragments would the strand shown be cut by HindIII?

3

An allele for lactase persistence allows humans to digest milk as adults. People who lack this allele are lactose intolerant in adulthood.

What is the pattern of inheritance?

Lactase persistence is autosomal dominant.

In an area of forest measuring 100 m by 100 m, samples were taken to estimate the number of silver maple (Acer saccharinum) trees in the forest. The number of trees counted in each of five areas of 400 m^2 was recorded.

Approximately how many silver maple trees are in the 10 000 m^2 area of forest?

125

The diagram shows the carbon cycle.

Which two processes correspond to the labelled arrows?

J is combustion and K is respiration

An experiment was set up so that each test tube contained water at a pH of 6.3 and a pH indicator. Test tubes 1 and 2 also contained a common pond autotroph. Carbon dioxide dissolves in water and forms carbonic acid. After three days the four test tubes were found to have these results.

What conclusion can be drawn from test tube 1 and test tube 2?

Test tube 1: Photosynthesis has used CO2

Test tube 2: Respiration has produced CO2

Which of these structures is not homologous?

C

What causes variation within a population

Fertilization and mutation

Which of the organisms A-D, identified by the key, represents a reptile?

B

The table shows the number of differences between humans and other selected organisms for the protein cytochrome c oxidase. This protein, consisting of 104 amino acids, is located in the mitochondria and functions as an enzyme during cell respiration.

If the data were used to draw a cladogram, which chordates would be furthest apart from humans?

Tuna fish because it is the chordate with the most differences

Dialysis membrane was set up to model digestion and absorption in the small intestine.

What is a limitation of this model?

There can be no active transport.

The diagram shows red blood cells and undifferentiated tissue cells.

Diffusion of oxygen from blood cells to tissue cells is represented by arrow 3 in the diagram. What molecules are shown diffusing by arrow 1 and arrow 2.

Arrow 1: glucose

Arrow 2: carbon dioxide

What is a characteristic of antigens?

They stimulate the production of antibodies

What can protect the body from blood loss?

Fibrin

Which structure in the motor neuron is required for saltatory conduction?

C

Which hormone inhibits appetite?

Leptin

What is the name and source of the hormone that regulates basal metabolic rate?

Name: thyroxin

Source: thyroid gland