meowlecular chp 1-2 tb qs

What is the function of DNA in the cell?

DNA is a storage system for genetic

information.

Compare the structure of the nitrogen bases. How do

purines and pyrimidines differ?

Purines have a double ring; pyrimidines

have a single ring

Write the complementary sequence to the following:

5′AGGTCACGTCTAGCTAGCTAGA3

3′TCCAGTGCAGATCGATCGATCT5′

Which of the ribose carbons participate in the

phosphodiester bond?

The 5′ carbon connects to a hydroxyl

group on the 3′ ribose carbon of the previous

nucleotide.

Which of the ribose carbons carries the nitrogen

base?

1′ carbon carries the nitrogen base.

Why does DNA polymerase require primase

activity?

A 3′ hydroxyl group from an existing

nucleotide must be present to form the

phosphodiester bond.

Underline two inverted repeats in the following RNA.

5′CUGAACUUCAGUCAAGCAAAGAGUUUGCACUG3′

5′CUGAACUUCAGUCAAGCAAAGAGUUUGCACUG3′

Name three processing steps undergone by

messenger RNA

mRNA is capped during transcription

and polyadenylated as part of termination. The

transcript is further processed by splicing.

What is the function of polyadenylate polymerase?

this enzyme adds adenosine nucleotides

to the 3′ end of mRNA.

What is unusual about the phosphodiester bond

formed between mRNA and its 5′ cap?

The phosphodiester bond involved in

capping is a 5′ñ5′ bond, rather than the more

usual 3′ñ5′ bond.

The parts of the hnRNA that are translated into

protein (open reading frames) are the

exons

The intervening sequences that interrupt protein-

coding sequences in hnRNA are

introns

What is a ribozyme?

A ribozyme is an RNA molecule

that can metabolize other molecules like an

enzyme.

Proteins that bind to DNA to control gene expression

are called ______ factors

trans (or transcription) factors.

The binding sites on DNA for proteins that control

gene expression are ____ factors

cis

How might a single mRNA produce more than one

protein product?

single RNA may be alternatively

spliced to produce more than one protein

product.

he type of transcription producing RNA that is

continually required and relatively abundant in the

cell is called ___ transcription.

constitutive

A set of structural genes transcribed together on one

polycistronic mRNA is called _____

operon

Indicate whether the following events would

increase or decrease expression of a gene:

Answer:

a. Methylation of cytosine bases 5′ to the gene

would ____ expression.

b. Histone acetylation close to the gene would

_____ expression.

c. siRNAs complementary to the gene transcript

will _____ expression.

decrease/ increase/ decrease

How does the complementarity of siRNA to its

target mRNA differ from that of miRNA?

The complementarity of siRNA to its

target is exact. The complementarity of miRNA

to its target is imperfect.

What sequence structures in DNA, usually found

5′ to structural genes, are frequent sites of DNA

methylation?

CpG islands (more than the expected

frequency of CG dinucleotides within a given

length of DNA), often found 5′ to structural

genes, are targets for methylation.

What is the RISC?

the RNA-induced silencing complex

mediates the specific interaction between siRNA

or miRNA and the target RNA.