I've got the mass.

The liver performs all of the following functions except

A) Blood glucose regulation

B) Processing of foreign molecules

C) Storage of energy in the form of fat

D) Synthesis of plasma protein

E) Synthesis of urea

Storage of energy in the form of fat

During fasting and prolonged starvation, skeletal muscle

A) Protein is degraded to provide amino acids to the liver for gluconeogenesis

B) Released as fat into the blood for storage in adipose tissue

C) Is synthesized from blood lactate

D) Converts glutamine molecules to proline

E) None of the above are correct

Protein is degraded to provide amino acids to the liver for gluconeogenesis

The cells that line the small intestine, which are responsible for the absorption of nutrients into the body, are

called

A) Adipocytes

B) Tubule cells

C) Hepatocytes

D) Enterocytes

E) Epithelial cells

Enterocytes

The functions of the kidney include all of the following except

A) Blood pH regulation

B) Body water regulation

C) Reabsorption of electrolytes, sugars, and amino acids from the urinary filtrate

D) Filtration of blood plasma which results in the excretion of water-soluble waste products

E) Production of urea from ammonia

Production of urea from ammonia

The most distinctive characteristic of living organisms is

A) Cellular structure

B) The autonomous capacity to sustain adequate operating conditions

C) Utilization of carbon compounds as food

D) Complex cellular mechanisms

E) Utilizing environmental materials as energy sources

The autonomous capacity to sustain adequate operating conditions

A simple system for information flow is composed of three components : reception, transduction and

response. In multicellular organisms hormones play a role in which phase?

A) Reception

B) Transduction

C) Response

D) Hormones are not involved in the process of information flow

E) Both A and B are correct

Reception

In a metabolic steady state the rate of anabolic processes is approximately equal to:

A) Catabolic processes

B) Cellular energy needs

C) Nutrient intake

D) Cellular repair and growth

E) B and C

Catabolic processes

In animals the vast majority of water-soluble hormones are

A) Peptides

B) Steroids

C) Polypeptides

D) Carbohydrates

E) A and C

A and C

The molecules that mediate the growth-promoting actions of GH are referred to as the

A) Interferons

B) Mitogens

C) Insulin-like growth factors

D) Both B and C are correct

E) None of the above are correct

Both B and C are correct

Symptoms of uncontrolled diabetes mellitus include all of the following except

A) Hyperosmolar hyperglycemic nonketosis

B) Hypoglycemia

C) Hyperlipoproteinemia

D) Ketoacidosis

E) Polyuria

Hypoglycemia

Steroid hormones

A) Are transported in blood attached to transport proteins

B) Bind to intracellular receptors

C) Diffuse through the plasma membrane of target cells

D) Both A and B are correct

E) All of the above are correct

All of the above are correct

Which of the following is not a major source of extracellular signal molecules?

A) Steroids

B) Modified amino acids

C) Carbohydrates

D) Fatty acids

E) Proteins

Carbohydrates

The biological effects of atrial natriuretic factor appear to be mediated by ______.

A) cAMP

B) cGMP

C) PIP 2

D) AG

E) IP 3

cGMP

In animals the ______ system has a primary responsibility for co-ordinating metabolism.

A) Nervous

B) Lymphatic

C) Hepatic

D) Endocrine

E) A and D

A and D

The IP 3 receptor

A) Binds cGMP

B) Is associated with G i

C) Is a calcium channel

D) Both B and C are correct

E) All of the above are correct

Is a calcium channel

A DNA segment that binds a hormone-receptor complex is called a _________.

A) DRE

B) DAG

C) EGF

D) HRE

E) IGF

HRE

Calmodulin is a

A) Transmembrane receptor

B) Calcium-binding protein

C) HSP

D) Plant hormone

E) A, B and C are correct

Calcium-binding protein

Insulin resistance is

A) A risk factor for Type I diabetes

B) A risk factor for Type II diabetes

C) Caused by excessive production of ANF

D) Associated with damage to the adrenal gland

E) None of the above are correct

A risk factor for Type II diabetes

Receptors for most water soluble hormones are located in what part of the cell?

A) Plasma membrane

B) Endoplasmic reticulum

C) Nucleus

D) Cytoplasm

E) Nuclear membrane

Plasma membrane

The most prominent mechanism to prevent excessive hormone syntheis is

A) Desensitization

B) Downregulation

C) Feedback inhibition

D) Target cell stimulation

E) Sensitization

Feedback inhibition

Enterocytes require large amounts of energy supplied by

A) Glucose oxidase

B) Fatty acid degradation

C) Lactose oxidation

D) Glutamine

E) Alanine

Glutamine

The organ responsible for processing most foreign molecules is

A) Intestine

B) Stomach

C) Liver

D) Kidney

E) Blood

Liver

Insulin-resistance is associated with all of the following except _______.

A) Obesity

B) Desensitizatioin

C) Down-regulation

D) IDDM

E) NIDDM

IDDM

Biochemical signal molecules include _________

A) Amino acids

B) Fatty acid derivatives

C) Steroids

D) Peptides

E) All of the above are true

All of the above are true

Receptor tyrosine kinases are transmembrane receptors that bind ligands such as

A) Insulin

B) Epidermal growth factor

C) Platelet derived growth factor

D) Insulin like growth factor

E) All of the above

All of the above

Which of the following molecules is a second messenger?

A) TSH

B) cGMP

C) Proline

D) Calcium

E) Both B and D are correct

Both B and D are correct

The organ responsible for the regulation of blood pH is

A) Liver

B) Kidney

C) Intestine

D) Brain

E) Stomach

Kidney

Most diabetic complications are the result of

A) Glycation

B) Hyperglycemia

C) Damage to the vascular system

D) Both A and B are correct

E) All of the above are correct 1

All of the above are correct 1

The principle target tissues of insulin include

A) Skeletal muscle

B) Liver

C) Adipose tissue

D) Both B and C are correct

E) All of the above are correct

All of the above are correct

Animals employing several mechanisms to prevent excessive hormone action and release. Examples include

which of the following?

A) Genetic regulation

B) Feedback inhibition

C) Desensitization

D) Down regulation

E) All of the above are true

All of the above are true

Which of the following molecules do GPCRs not respond to?

A) Catecholamines

B) Oxytocin

C) Light

D) Dopamine

E) Insulin

Insulin

Which of the following is a role of PKB?

A) Stimulation of glycogen synthesis

B) Inhibition of lipolysis

C) Glucose transport into adipocytes

D) Activation of mTOR

E) All of the above are roles of PKB

All of the above are roles of PKB

An example of a cytokine is

A) Epidermal growth factor

B) Interleukins

C) Interferons

D) Insulin-like growth factors

E) B and C

B and C

The most serious acute symptom of type 1 diabetes is

A) Anemia

B) Ketoacidosis

C) Hypoglycemia

D) Insulin resistance

E) Both A and C are correct

Ketoacidosis

Hyperosmolar hyperglycemic non-ketosis can occur in type _____ Diabetes

A) Type I

B) Type II

C) Insulin dependent diabetes

D) Is present in all forms of diabetes

E) Is not a symptom of diabetes

Type II

During periods of starvation muscle reduces its consumption of glucose. This spares its use for which of the

following organs?

A) Liver

B) Heart

C) Kidneys

D) Brain

E) Lungs

Brain

Leptin is secreted by which of the following tissues?

A) Brain

B) Liver

C) Adipose tissue

D) Muscle

E) Gasterintestinal tract

Adipose tissue

The brain consumes about _______% of the body's energy.

A) 10

B) 20

C) 30

D) 40

E) 50

20

The phosphatidylinositol cycle mediates the action of all of the following except ______.

A) Acetylcholine

B) Insulin

C) Glucagon

D) Vasopressin

E) GRH

Glucagon

Metabolism of fructose in the liver rapidly depletes which of the following

A) NADPH

B) ATP

C) Triose phosphate

D) AMP

E) Glucose

ATP

An autoimmune disease caused by the destruction of the insulin producing beta cells of the pancreas is

called

A) Hyperglycemia

B) Dyslipidemia

C) Glucosuria

D) Type II diabetes

E) Type I diabetes

Type I diabetes

Extreme thirst and frequent urination in diabetics is directly caused by

A) Osmotic diuresis

B) Hyperglycemia

C) Dyslipidemia

D) Glucosuria

E) Adipoisledimia

Glucosuria

Type II diabetes is uniquely characterized by:

A) Hyperinsulinemia

B) Depressed insulin levels

C) Insulin resistance

D) Depressed glucose levels

E) A and C

A and C

Which of the following carbohydrates is a major contributing cause of dyslipidemia non-alcoholic fatty

liver disease?

A) Glucose

B) Ribose

C) Fructose

D) Galactose

E) Xylose

Fructose

Urea synthesis is the responsibility of which organ of the body?

A) Kidney

B) Liver

C) Intestine

D) Stomach

E) Lung

Liver

There are approximately _________ human genes.

a. 10,000

b. 20,000

c. 100,000

d. 1,000,000

e. 10,000,000

20,000

______ are gene sequences that code for a gene product.

a. Introns

b. Exons

c. Nucleosomes

d. Cruciforms

e. Snurps

Exons

A genome is

a. The sequence that contains the base sequence information necessary to code for a gene product

b. The complete DNA base sequence in an organism

c. The complementary pairing of purine and pyrimidine bases

d. A base pair

e. A newly synthesized RNA molecule

The complete DNA base sequence in an organism

Protein synthesis is called

a. Translation

b. Transcription

c. Replication

d. A metabolome

e. Proteone

Translation

The entire set of proteins synthesized by a cell is called

a. Metabolome

b. Genome

c. Proteome

d. Epigenome

e. Transcriptome

Proteome

The polyamines assist in the compression of eukaryotic chromosome structure because they

a. Contain functional groups that bond to DNA

b. Assist in the formation of telomeres

c. Possess positive charges that interact with the negative charges of DNA

d. Promote chemical modification of the histones

e. None of the above are correct

Possess positive charges that interact with the negative charges of DNA

In nucleosome structure the histone ________ aids in stabilizing the wrapping of DNA around the protein

octomer.

a. H1

b. H2A

c. H2B

d. H3

e. H4

H1

Chromatin contains several levels of structure which include

a. Nucleosomes

b. 200 nm filaments

c. 30 nm fiber

d. Both B and C are correct

e. All of the above are correct

All of the above are correct

D loops and variable loops are found in _______

a. mRna

b. rRNA

c. tRNA

d. hnRNA

e. snRNA

tRNA

Which of the following are involved in the splicing of RNA molecules?

a. Snurps

b. snRNA

c. rRNA

d. Both A and B are correct

e. None of the above are correct

Both A and B are correct

The DNA strand that acts as a template during transcription is referred to as the ______ strand.

a. Sense

b. Antisense

c. Transcribed

d. All of the above are correct

e. None of the above are correct

Antisense

Determine the mRNA sequence for the following DNA sequence 5'-GCCATTTCCCGTTA-3'

a. 5'-CGGTAAAGGGCAAT-3'

b. 5'-CGGUAAAGGGCAA-3'

c. 5'-TAACGGCAAATGGC-3'

d. 5'-UAACGGCAAAUGGC-3'

e. 5'-UAACGGGAAAUGGC-3'

5'-UAACGGGAAAUGGC-3'

During a transition mutation which of the following bases would be substituted for cytosine?

a. Thymine

b. Adenine

c. Guanine

d. Both B and C are correct

e. All of the above are true

Thymine

The polyamines are a class of DNA binding molecules that include ______.

a. Spermine

b. Speruline

c. Spermidine

d. Both A and C are correct

e. All of the above are correct

Both A and C are correct

_______ are structures that occur at the ends of chromosomes

a. Cistrons

b. Telomeres

c. Cruciforms

d. Centromeres

e. Capsids

Telomeres

HIV infection of a susceptible cell is initiated when the gp120 envelope protein binds the _______ antigen

a. T4

b. C4

c. T2

d. C2

e. None of the above are correct

None of the above are correct

HIV is a type of

a. Pox virus

b. Rhabdovirus

c. Herpes virus

d. Papilloma virus

e. Retrovirus

Retrovirus

HIV possesses a ________ genome

a. ssDNA

b. dsDNA

c. ssRNA

d. dsRNA

e. None of the above are correct

ssRNA

Hydroxyapatite

a. Is a calcium phosphate gel

b. Binds to double stranded DNA

c. Is used in column chromatography

d. Both A and C are correct

e. All of the above are correct

All of the above are correct

Southern blotting

a. Is a technique used to identify specific genes

b. Binds to double stranded DNA

c. Is a chain terminating method

d. Both A and B are correct

e. All of the above are correct

Both A and B are correct

The genetic variations observed in DNA fingerprinting are referred to as ______.

a. RFLPSs

b. RLFPs

c. FRLPs

d. DFLPs

e. DLFPs

RFLPSs

The extraction and purification of bacterial DNA involves the use of which of the following.

a. RNase

b. Lysozyme

c. Phenol and chloroform

d. Both A and B are correct

e. All of the above are correct

All of the above are correct

Palindromes

a. Form cruciforms

b. Contain inverted repeats

c. Are sequences that provide the same information whether they are read forward or backwards

d. Play a role in the function of the restriction enzyme

e. All of the above are correct

All of the above are correct

The denaturation of DNA is

a. Promoted by the heat, low salt concentration, and extremes of pH

b. Reversible

c. Monitored by measuring the absorbance at 300nm

d. Both A and B are correct

e. All of the above are correct

Both A and B are correct

The chain terminating method for sequencing DNA was developed by

a. Maxam and Gilbert

b. Frederick Sanger

c. Watson and Crick

d. Hershey and Chase

e. None of the above are correct

Fredrick Sanger

In a transversion mutation

a. A purine base is substituted for a pyrimidine base

b. A pyrimidine base is substituted for a purine base

c. A purine or pyrimidine base is framsehifted

d. Both A and B are correct

e. All of the above are correct

Both A and B are correct

A nucleoid is:

a. Supercoiled DNA attached to a protein core

b. Negatively supercoiled DNA

c. Positively supercoiled DNA

d. Relaxed DNA

e. Either B or C depending on the organism

Supercoiled DNA attached to a protein core

Chromatin is:

a. Supercoiled DNA

b. DNA complexed with histones

c. Linear uncoiled DNA

d. Relaxed DNA

e. Genes

DNA complexed with histones

Intergenic sequences are

a. DNA segments that do not code for gene product

b. Junk DNA

c. DNA that codes for more than one product

d. DNA which stabilizes the nucleosome

e. Both A and B are correct

Both A and B are correct

Restriction enzymes

a. Prevent DNA synthesis

b. Prevent RNA synthesis

c. Prevent protein synthesis

d. Cut DNA at specific base sequences

e. Both A and B are correct

Cut DNA at specific base sequences

The hypochromic effect is

a. The aggregation of chromatin into large clusters

b. The shift of light absorption to longer wavelengths

c. The formation of chromatin-histone complexes

d. The conversion of B-DNA to Z-DNA

e. The shift of light to shorter wavelengths

The shift of light absorption to longer wavelengths

Which of the following is the largest and most complex structure?

a. Genes

b. Nucleotides

c. Nucleosomes

d. Chromosomes

e. Chromatin

Chromosomes

Which of the following is not a function of RNA?

a. Regulation of gene expression

b. Cell differentiation

c. Catalysis

d. Both A and C are functions of RNA

e. All of the above are functions of RNA

All of the above are functions of RNA

Lysogeny is:

a. Cleavage of the cellular RNA

b. Infection of the host cell by a virus

c. Integration of the virus genome into the host chromosome

d. Formation of the prophage from the viral coat

e. None of the above are correct

Integration of the virus genome into the host chromosome

A defect in which of the following HAR's can result in microcephaly?

a. ASPM

b. FOXP2

c. AMY 1

d. LCT

e. HAR1

HAR1

A mutation caused by an alkylating agent is referred to as

a. Transversion mutation

b. Silent mutation

c. Missing mutation

d. Point mutation

e. Nonsense mutation

Transversion mutation

Which of the following is not an endogenous cause of DNA damage?

a. Tautomeric shift

b. Radiation

c. Deamination

d. Depuration

e. ROS induced oxidation

Radiation

SAM is a methyl donor in the synthesis of

All of the above are correct

A simple system for information flow is composed of

three components : reception, transduction and

response. In multicellular organisms hormones play a role

in which phase?

Reception

Which of the following is an siRNA for eukaryotes?
a) ACUGAAUTCGGCTAAUUTCGGCUAT

b) ACUUAAUGCGCGCUAAUCGCCCGGG

c) ACUUAAUGCUAUAUAGACUAGCCUAGUCCGGCGAAUUAAACCGGGCACCUUU

d) ATCCGCGCTTATCGATCCGATTTAGCCGATTTA

a) ACUGAAUTCGGCTAAUUTCGGCUAT
Has Uracil and Thymine

Which of the following can sequence RNA fragments?

Northern Blotting

Which of the following is a synonymous codon with UCU?

A) AAU

B) UCA

C) GAU

D) AAA

B) UCA

Protein synthesis requires _____ high energy phosphate

bonds per peptide bond.

4

_______ are a group of molecules that mediate protein

folding.
A) Hsp 70s

B) Chaparonins

C) Docking protein

D) Both A and B are correct 3

E) All of the above are correct

Both A and B are correct 3

Eukaryotic mRNA stability involves

A) Reversible adenylation

B) The length of poly (A) tails

C) The binding of specific proteins to certain mRNA

sequences

D) The action of various nucleases

E) All of the above are correct

All of the above are correct

21. ________ provides the energy needed to move the ribosome

along the mRNA.

A) ATP

B) GTP

C) UTP

D) TTP

E) All of the above are correct

B) GTP

In eukaryotic translation the 40S complex binds the 60S

subunit to form the _______ initiation complex.

80S

The Shine-Dalgarno sequence is a

Prokaryotic mRNA sequence that binds 16S rRNA

of the small ribosomal subunit

__________ corrects replication proofreading errors.

Mismatch Repair

Topoisomerases

A) Join DNA strands together
B) Prevent tangling of DNA strands
C) Relieve torque in replicating DNA
D) Change the supercoiling of DNA
E) All of the above are correct

All of the above are correct

In the absence of its inducer the lac operon remains

repressed because of the binding of lac repressor to the _______.

Operator

Place the following steps of general recombination in

chronological order

i. DNA ligase seals the cut ends

ii A second series of DNA strand cuts occurs opposite the first crossover strands

iii Two homologus DNA molecules become paired

iv DNA polymerase fills any gaps and DNA ligase seals the cut strands

v Two of the DNA strands are cleaved

vi The two strand segments cross over

iii, v, vi, i, ii, iv

Many promoters for RNA polymerase II contain a consensus

sequence call the _______.

TATA box

DNA transposition can cause gene ______.

A) Duplication

B) Deletion

C) Transcription

D) Both A and B are correct

E) All of the above are correct

Both A and B are correct

DNA synthesis is called

Replication