Bio 101 NVCC Final Exam

Meisosis results in

4 different haploid cells

The purpose of meiosis is to

produce gametes (eggs and sperm)

There are _____ Cell divisions in meisosis

2

Meiosis occurs in the _______

Ovary or testes

DNA replication occurs during ________

Interphase 1

Recombination or 'crossing over' occurs in ________

Prophase 1

Independent assortment of homologous chromosomes occurs in ________

Interphase 1

The DNA condenses, nuclear envelope disintegrates and centrioles move to opposite poles, during ________

Prophase 1 and Prophase 2

The homologous chromosomes pair up during

Prophase 1

Individual (single) chromosomes are arranged on the equator during ________

Metaphase 2

The sister chromatids seperate from each other during

Anaphase 2

The homologous chromosomes separate from each other during ________

Anaphase 1

New nuclei form and the spindle fibers disintegrate during ________

Telophase 1 and 2

Oogenesis occurs in the ________

Ovaries

Spermatogenesis begins at ________

puberty

Oogenesis ends at ________

menopause

If fertilization occurs, the result of oogensis is

1 egg, 2 polar bodies

Sperm are very large, mobile, and have a tail called a flagellum. True or False?

True

Eggs are very large, immobile and don't have a tail. True or False?

True

A woman can release (Ovulate) millions of eggs in her lifetime. True or False?

False

Alleles are ________

alternate forms of a gene

Mendel counted up ________ in pea plants

Phenotypes

Whether a trait is dominant or recessive is based on ________

The phenotype of the heterozygote

A Genotype that is homozygous means ________

That each allele is the same, ie, AA, aa, BB, bb.

When an individual has two different alleles, they are ________

Heterozygous

When an individual has two identical alleles, they are ________

Homozygous

The appearance of an individual is the ________

Phenotype

A test cross is set up to determine:

The genotype of the dominant individual

If one allele masks (hides) the expression of the other allele, the masked allele is ________

Recessive

If a trait is equally as likely to be inherited by males as females, it is ________

autosomal

Albinism is an autosomal recessive trait. A man and a woman who are both wild type, have a child with albinism. The genotype of the child can be:

aa

Albinism is an autosomal recessive trait. A man and a woman who are both wild type, have a child with albinism. The genotype of the mother is:

Aa

Albinism is an autosomal recessive trait. A man and a woman who are both wild type, have a child with albinism.

The probability that their next child is a carrier (heterozygous) is:

2/4

Albinism is an autosomal recessive trait. A man and a woman who are both wild type, have a child with albinism.

The probability that their next child has albinism is:

1/4

Having freckles is an autosomal dominant trait. A man without freckles has a child with a woman has freckles. The woman's mother does not have freckles.

The chance that they will have a child with freckles is:

2/4

Having freckles is an autosomal dominant trait. A heterozygous couple who both have freckles, have a _____ chance of having a child without freckles:

1/4

Pedigrees show the pattern of inheritance of several genetic disorders within a family. True or false?

False

In pedigrees, squares represent females. True or false?

False

If the phenotype of the heterozygote is intermediate between the homozygous parents, it is probably an incomplete dominant trait.. True or false?

True

A blood type A person can donate blood to someone who is blood type AB. True or false?

True

Helicase:

unwinds the DNA double helix

Ligase:

joins DNA fragments together

RNA Primer

RNA piece requuired to get DNA Polymerase started

This strand discontinuously builds new DNA

Lagging

Anti-Parralel DNA strands

One DNA strand runs 3' to 5' while the other runs 5' to 3'

Okasaki fragments

short pieces of DNA on the lagging strand

DNA polymerase

Adds/builds new DNA in a 5' to 3' direction

This strand continuously builds new DNA

Leading

Semi-Converative replication is

the new DNA double helix has one old strand and one new strand

Complementary DNA base pairing for DNA Replication

A-T, C-G

Give the complementary sequence of DNA on the opposite strand - and label the 5' and 3' end:

3' CATTAGAAGCTAAAGCGCTATAT 5'

5' GTAATCTTCGATTTCGCGATATA 3'

Original DNA strand: 5 ' ATACAGATTAACCGG _________________________________ REPLICATION FORK moving to the right


Original DNA strand: 3' TATGTCTAATTGGCC ___________________________________


Fill in the leading and lagging strands and label the 5' and 3' ends:

Original DNA strand: 5 ' ATACAGATTAACCGG _________________________________ REPLICATION FORK moving to the right

3' TATGTCTAATTGGCC lagging strand ________________

5 ' ATACAGATTAACCGG leading strand ____________

Original DNA strand: 3' TATGTCTAATTGGCC ___________________________________

Sugar preset in DNA

Deoxyribose

Type of sugar in RNA

Ribose

Nitrogenous bases in DNA

ACG&T

Nitrogenous bases in RNA

ACG&U

Number of strands in DNA

Two

Number of strands in RNA

One

What is the promoter DNA sequence?

DNA sequence that is bound by transcription factors

What is a Transcription factor?

A Protein that binds the promoter region of DNA.

What is RNA Polymerase?

Builds new RNA in a 5' to 3' direction

What is mRNA processing?

It's a necessary function that prepares the pre-mRNA for translation (occurs before translation).

What is the Coding DNA strand?

The pre-mRNA is the same as this sequence, just in RNA form.

What is the template DNA strand?

The pre-mRNA is complementary to this sequence.

What is a poly-A tail?

A tail added to the 3' end of mRNA that prevents it from being degraded.

What is a G-Cap?

A header added to the 5' end of the mRNA that allows it to exit from the nucleus.

What is an Intron?

Part of DNA sequence that are removed from the pre-mRNA

What is an Exon?

It's part opf the DNA sequence that are kept in the mRNA.

transcribe this section of exon DNA on the Coding strand:

5' GCATGTTCAGGCTAAGCTACCTGTGAC 3'

5' GCAUGUUCAGGCUAAGCUACCUGUGAC 3'

List all blood types.

A, B, AB, O

What is a pedigree?

A chart that shows a single disorder within a family.

On a pedigree, what does a circle mean?

Female.

On a pedigree, what does a square mean?

Male.

What is complete/simple dominance?

One characteristic is dominant over the opposing one. So, white skin color could be dominant to darker skin color or vice versa.

What is incomplete dominance?

Where both phenotypes are merged; ie, black cow and white cow have a calf; the calf is grey.

Give the genotypes of all blood types.

A- Ia Ia or Ia Io
B- Ib Ib or Ib Io
O- Io Io

When does hemolytic disease occur?

When a woman is pregnant and their baby is Rh negative.

Where and when does replication occur?

S1 in Interphase

What does gene expression mean?

That a gene is specific to tissue, so a liver tissue can't function as a skin gene.

Where does Translation occur? What about transcription?

Translation- Cytoplasm
Transcription- Nucleus

What is a codon?

Set of three mRNA bases.

Give the instructions for translation.

1.) Find the 5' end by locating the G-Cap.
2.) Search for 'Aug' start codon.
3.) Set reading prime codons.
4.) Continue, one codon at a time.
5.) Translation ends at a 'Stop' codon
6.) Amino acid chain disengages from mRna and folds into 3-D.

What is a simple tip for Translation?

Keep all bases, only change T's to U's.

What is a Germ-line mutation?

mutation that occurs in germ cells. Can be transmitted to progeny and become a good or bad polymorphism in the gene pool.

What is a somatic mutation?

One mutation that occurs in a body cell that is not passed on to the offspring.

What are the two causes of mutation and what are their definitions?

Indused: Mutagens such as X-Rays, UV, smoking, etc.
Spontaneous: Caused by DNA replication that didn't perform well.

List types of mutations. Rank them in order of effect on protein products.

Frame Shift: Extremely bad, either done by an insertion mutation or deletion mutation. Either way, this moves all codons by one in either direction.
Substitution: Not as bad, just changes a base.

Mutations can be positive or negative, give two examples of negative or positive mutations.

Positive: Advanced hearing, advanced camouflage.
Negative: Blind or bright colored.

Name the two events in meiosis that contribute to gene reorganization

Cross over/ recombination and Independent assortment.

What is the blood type that is the universal receiver, including ABO and Rh?

AB pos