BIOL 2160 - Exam 1 Study Material: Scott Crousillac

Function is to structure

Physiology is to anatomy as:

Nervous Tissue

Which tissue type is specalized for sending and recieving information?

Connective Tissue

Upon examining an unknown tissue specimen, you disover that the tissue has very few cells & consists mostly of extracelluar material. This tissue type is most likely:

Endocrine

Measuring thyroxine levels in the blood is an indicator of thyroid gland activity. The thyroid gland is an example of______gland.

Oxytocin causes uterine contractions, which results in oxytocin being released

Which of the following is an example of a positive feedback mechanism?

Hydroxyl

Addition of which of the following functional groups to a molecule will result in the greatest increase in its solubility in water?

Nonpolar covalent bond

The molecule N-C contains which type of bond?

Bc electrons are more attracted to the nucleus of oxygen than they are to the nucleus of hydrogen

Why is water such a polar molecule?

5 Carbon atoms (1:2:1 ratio)

If you were given a particular monosaccharide, & counted 10 hydrogen atoms in it, how many carbon atoms would be present?

They have both polar & nonpolar regions (head & tail)

What makes phospholipids different than most other lipids?

Primary

Changing the amino acid sequence of a protein has a direct effect on which level of protein structure?

Nucleotides/Amino Acids

Translation is the process of converting the language of ____ to the language of proteins

On the outside

Where would you expect to find amino acids with polar side chains on a cytosolic protein?

30%

Within a particular DNA molecule, you discover that 20% of the bases are Adenine. What percentage is Guanine?

3' end

. Following transcription, the poly-A portion of the pre-mRNA transcript will be at which end?

tRNA

Anticodons are located on which molecule?

Protein Synthesis (smooth is responsible for lipids)

If the Rough Endoplasmic Reticulum were to become damaged in a particular cell, which of the following processes would be MOST affected?

Nucleolus

The rRNA needed to make ribosomes comes from:

Golgi apparatus (like the FeDex of the cell)

Which organelle's primary function is packaging and sorting proteins?

Polymerase

Which enzyme is responsible for adding complementary ribonucleotides during transcription?

Exons

. When an mRNA transcript binds to a ribosome, the mRNA is composed of:

90

A protein that is 30 amino acids long will most likely be coded for by a transcript that is _____ nucleotides long.

4

The following transcript will code for a protein that is _____ amino acids long. AGAGGGCCUUAGAUGCCCGACGCAUGACCCGCGUG ACCG

P site

. During translation, which site on the ribosome contains a tRNA with several amino acids attached to it?

A site

Which site on the ribosome will receive the tRNA with the next amino acid to be added?

Engergonic

A chemical reaction in which the products have more energy than the reactants would be _____.

Catabolic (bc breaking down glucose)

Glycolysis is an example of ______ reaction.

By lowering the activation energy

How do enzymes speed up biological reactions?

Very high substrate concentrations

Enzymes with different affinities for substrates will have the same reaction rate at:

Low

Affinity between an enzyme & a substrate will have an effect at____substrate concentrations.

Kinase ;

A _____ adds a phosphate group to an enzyme, and turns it _____.

Feedback inhibition

The pathway is an example of:

it requires oxygen

Which of the following is FALSE about glycolysis?

Glycogenesis

Which of the following processes results in an increase in glycogen levels?

Acetyl coA (input)

Which molecule physically enters the Kreb's Cycle?

2

How many turns on the Kreb's cycle are needed to completely break down one molecule of glucose?

4 ATP molecules

How many molecules of ATP are produced from one molecule of glucose that undergoes glycolysis, the linking step, and 2 turns of the Kreb's cycle?

90%

Of the total ATP produced during cellular respiration, what percentage is generated by the electron transport chain?

10%

What percentage of the total ATP prouduced is made during the first 3 stages of celluar respiration?

Into the intermembrane space

During chemiosmosis, where do protons get pumped?

36 ATP

The theoretical ATP yield for one molecule of glucose that completely undergoes cellular respiration is:

Regenerate NAD+ for glycolysis

What is the purpose of fermentation?

it Receieves electrons at the end of the electron transport chain

What is the purpose of oxygen during cellular respiration?

Glycogenolysis or ATP Hydrolysis

Which of the following is a common exergonic reaction that is coupled to many endergonic reactions in the cell?

Introns (junk)

Pre-mRNA transcripts contain ______, while mRNA transcripts do not.

Tertiary (3-D shape)

Melting/denaturing enzymes will destroy its ______ structure.

Engergoinc

Glycogenesis is an example of an ______ reaction.

in the Cytoplasm

Where does glycolysis occur?

RNA

Which of the following molecules will contain a sugar with an oxygen present in the 2' position?

Released

As electrons are transferred down the electron transport chain, potential energy is:

UGA ; UAG ; UAA

What are the stop Codons?

AUG

What is the start codon?

Proteins would remain in the ON position too long

If phosphates were to stop functioning in a cell, what would be the immediate consequence?

2 Acetyl coAs & 2 NADH

What gets produced during the linking step of cellular respiration?

Catabolic

_____: Breakdown, release energy.

Anabolic

____: produce, add energy.

Endergonic

____: add energy.

Exergonic

____: release energy.