MLT 151 Unit 1 Carbs, lipids, immunoassays, and molecular diagnostics

What are some hormones that stimulate glycogenolysis?

Glucagon

Thyroxine

Epinephrine

(NOT Insulin)

Select the desirable cutoff for serum LDL cholesterol recommended by the National Cholesterol Education Program

100 mg/dL

A 52-year-old man went to his doctor for a physical examination. The patient was overweight and had missed his last two appointments because of business dealings. His blood pressure was elevated, his cholesterol was 250 mg/dL, and his triglyceride was 170 mg/dL. A high-density lipoprotein (HDL) cholesterol test was performed and the result was 30 mg/dL (20-60 mg/dL). Which of the following would be this patient's calculated low-density lipoprotein (LDL)

186 mg/dL

What enzyme is most specific for β-D glucose?

Glucose oxidase

What blood glucose level would you expect to result in glucose in the urine?

200 mg/dL

Which lipids are derivatives of fatty acids comprised of 20 C atoms including a 5 C cyclopentane ring?

Prostaglandins

In uncontrolled diabetes mellitus, cholesterol and triglycerides are [increased, decreased, or unaffected)

Increased

What is the primary hypoglycemic hormone?

Glucagon

What percentage of serum cholesterol is present in the form of esters

60-75%

The BORDERLINE range for cholesterol levels as determined by NCEP is

200-240 mg/dL

The lipoprotein fraction that has the highest ratio of lipid to protein is

Chylomicrons

A patient with an insulinoma may exhibit dizziness and fainting attributable to

Hypoglycemia

What type of hypoglycemia is exhibited 8 hours after a meal

Fasting

Cholesterol is/has a

Cyclopentanoperhydrophenanthrene nucleus

Acyl-cholesterol acyltransferase

Converts free cholesterol to esterified cholesterol for storage

Which of the following is characteristic of type 2 diabetes mellitus

Obesity and physical inactivity

[NOT juvenile onset, high insulin levels, or ketosis]

In the Hexokinase method for glucose determinations, the actual end product measured is the

NADPH + H+ produced from the reduction of NADP

Risk factors for coronary heart disease include

Diabetes mellitus

Other forms of atherosclerotic disease

Hypertension

[NOT High HDL cholesterol]

Which apolipoprotein has the ability to INCREASE the risk of coronary heart disease

Apo B100

Gluconeogenesis is

The formation of glucose from noncarbohydrate sources, for example, amino acids, glycerol, and lactate

The following are criteria for Clinical Diagnosis of Metabolic Syndrome

Elevated triglycerides

Reduced HDL-C

Elevated waist circumference

[NOT Low fasting glucose]

The following glucose tolerance test values are indicative of what state?

 

Fasting: 85 mg/dL

1/2 hour: 135 mg/dL

1 hour: 139 mg/dL

2 hour: 130 mg/dL

Normal

The serum of a freshly drawn blood sample is slightly turbid. This is probably because

Triglycerides only are increased

The enzyme that catalyzes the reaction ATP + D-glucose → ADP + D-glucose-6-phosphate is

Hexokinase

Glycolysis is

The conversion of glucose into lactate or pyruvate and then CO2 and H2O

A patient's low glucose, increased insulin, and increased C-peptide is caused by

Insulinoma

[NOT Glucagonoma, Addison's disease, or Injection of exogenous insulin]

Instructions for patients preparing for a glucose tolerance tests include

No food 10 hours before and during the test

Carbohydrate intake must be at least 150g/day for 3 days prior to the test

Patient must be ambulatory for 3 days prior to the test

[ NOT Caffeine and smoking are permitted before and during the test]

The enzymatic determination of glycerol in triglyceride analysis usually involves conversion of glycerol to

Glycerol phosphate

In a specimen collected for plasma glucose analysis, sodium fluoride

Inhibits glycolysis

Which of the following lipid fractions are very large molecules with a low density and give plasma a milky appearance when present in increased amounts

Chylomicrons

[NOT VLDL, HDL, LDL, or IDL]

The following are associated with gestational diabetes

Is defined as glucose intolerance during pregnancy

Associated with increased fetal risk

It converts to diabetes mellitus after pregnancy in 30-60% of patients

[NOT Is diagnosed using the same glucose tolerance criteria as in nonpregnant women]

All of the following statements about clinical hypoglycemia are true EXCEPT

Neuroglycopenic symptoms must be present at the time of the low blood sugar

Symptoms can be relieved by ingestion of carbohydrates

C-peptide levels are normal or elevated

[NOT High fasting insulin levels must be present to make a diagnosis]

The first step in the enzymatic cholesterol reaction, which results in free cholesterol esterase, is

Hydrolysis of cholesterol esters

The only hormone that causes a decrease in blood glucose levels is

Insulin

Which of the following test combinations indicates the HIGHEST risk for coronary heart disease

Increased total cholesterol, decreased HDL cholesterol

Complications of diabetes mellitus include

Nephropathy

Neuropathy

Heart disease and stroke

[NOT Hepatitis]

Which of the following carbohydrates is a polysaccharide

Starch

[NOT sucrose, glucose, or lactose => disaccharides]

Which form of diabetes usually manifests itself early in life, and is associated with ketosis, low insulin levels, and autoantibodies to islet cells

Type 1

The glucose concentration in normal cerebrospinal fluid is

60-75% of the plasma glucose concentration

The National Cholesterol Education Program ATP III goal for desirable HDL cholesterol is

≥ 60 mg/dL

Bile acids are synthesized in the liver from which lipid

Cholesterol

Which statement regarding glycosylated hemoglobin is TRUE

Is dependent upon the time averaged blood glucose over the lifespan of the RBC.

It has a sugar attached to the N-terminal valine of the β-chain of the hemoglobin molecule.

Levels below 7% indicate adequate regulation for 8-12 weeks prior to sampling.

[All of the above]

Which of the following is a group of interrelated metabolic risk factors that appear to directly promote the development of atherosclerotic cardiovascular disease

Metabolic syndrome

HDL cholesterol + LDL cholesterol + chylomicrons → HDL. Which is used as a precipitating reagent for determining cholesterol?

Heparin-manganese chloride

Phosphotungstate-Mn (II)

Dextran-sulfate-Mn (II)

[NOT Sulfosalicylic acid]

An isomer of glucose with the -OH group of the anomeric carbon C1 that is below the plane of the ring or on the right-hand side is

α -glucose

Secondary causes of elevated LDL include

Hypothyroidism

Chronic renal failure

Obstructive liver disease

(NOT Hyperthyroidism)

Glycogen is stored in the

Liver

Which of the following is TRUE concerning blood cholesterol concentrations

Cholesterol levels decrease following strenuous exercise

Increased cholesterol is associated with nephrotic syndrome

Increased cholesterol is associated with diabetes mellitus

Cholesterol levels are unchanged when comparing results from fasting and nonfasting blood

[NOT Increased cholesterol is associated with hyperthyroidism]

A sneaky diabetic tried to lower her glucose by working out and watching her diet 1 or 2 days before her appointment. The rest of the time she spent the day in front of the television and eating chocolates. What test could the doctor order to detect this type of behavior?

A glycosylated hemoglobin

Which of the following tests would be included in a routine lipid profile

Cholesterol, LDL-cholesterol, HDL cholesterol, triglycerides

Which of the following describes the composition of the two particles used in the luminescent oxygen channeling immunoassay (LOCI)?

One synthetic bead coated with Streptavidin that contains photosensitive dye and a second synthetic bead coated with a binding partner specific for the method and contains a chemiluminescent dye

The protein product derived from the DNA sequence below contains which of the following amino acid sequences?

DNA: 3' TACTTTCGCGGAACT 5'

Methionine-lysine-alanine-proline

AUG AAA GCG CCU UGA (stop codon)

Most proteins start with methionine

Which of the following is TRUE about gel electrophoresis of DNA?

Increasing the voltage increases the resolution of DNA fragments separated in the gel

RNA differs from DNA in that RNA

Contains an H group instead of an OH group at its number 2 carbon

Which of the following fragments would be generated when the following sequence is cut by SmaI?

5' TACCCCGGGGGCAATTCCCGGGAGATTCCCGGGAACTC 3'

One 4 bp fragment, one 10 bp fragment, one 11 bp fragment, and one 13 bp fragment

Cuts at CCCGGG

All of the following are clinical applications of FISH EXCEPT

Detecting DNA from tumor-causing viruses in cytologic specimens

Detection of chromosome microdeletions

Monitoring patients with s*x-mismatched bone marrow transplants for engraftment

[NOT Detection of oncogenes in tumor cells]

Restriction endonucleases function by

Cutting the DNA at specific nucleotide sequences

Labeled antibodies are used as probes to detect proteins in

Western blot

Which of the following is a component of a nucleotide

Nitrogenous base

5' carbon sugar

Phosphate group

[NOT Amino acid]

Suppose that a laboratory wanted to separate small DNA fragments that were 10 base pairs (bps) apart in size. The optimal technique to use for the separation is

Pulse-field gel electrophoresis

More nonspecific binding of a probe to DNA sequences in a sample is encouraged when

The temperature is decreased

Plastic beads, polyclonal gels, and particles coated with iron oxide used in immunoassays are all examples of which of the following?

Solid phase material

Which of the following best describes haptens?

Haptens are substances that are capable of binding an antibody but by themselves cannot stimulate an immune response

Monoclonal antibodies typically recognize

Single antigen sites

Which of the following is an example of a chemiluminescent compound?

Acridinium

[NOT Fluorescein, Luminol, or Cis-platinum]

In fluorescence polarization immunoassay (FPIA), the electrons in fluorescein molecules chemically attached to the hapten react in which of the following manner?

They do not fluoresce

Which statement best defines an antigen?

Any material capable of reacting with an antibody, without necessarily being capable of inducing antibody formation

As the concentration of analyte begins to exceed the amount of antibody present, the dose response curve will flatten (plateau) and with further increase may become negatively sloped; this describes which of the following?

Hook effect

Affinity is described as which of the following?

The thermodynamic quantity defining the energy of interaction of a single antibody-binding site and its corresponding epitope on the antigen

Which detector label is used in electrochemiluminescence immunoassays?

Ruthenium with tripropylamine