final exam microbial genetics- new stuff and old questions

______________ can be used for physical mapping of a plasmid

Restriction enzymes

If transposons get inserted into a gene, it is ALWAYS a ___________

mutation

what is the in vivo method of transposon mutagenesis

deliver transposon into cell, its expression depends on transfer of transposase genes

how do you do tn5 mutagenesis of a plasmid

deliver tn5 to cells with plasmid, select for transposition with Kan resistance, isolate plasmids from those without transposons, transform into cell with no plasmid, select for Kan resistance

issues with in vivo transposon mutagenesis

suicidal delivery system isn't effective, in vivo transposition is inefficient, lack of specificity (mutations on chromosome instead of plasmid), no useful transposon available for many species

general mode for tn5 transposition

transposase is made, binds to end of transposon, cleaves it out, transposase dimerizes, transposon is now separate from donor DNA

steps for in vitro transposon mutagenesis of a PLASMID

purify plasmid, mix transposases, mix target DNA, mutagenize plasmid into bacterial cells, some colonies will have tn

advantages of in vitro transposon mutagenesis

high efficiency, bypass host function for transposition, no 2 transposition

in vitro transposon mutagenesis of CHROMOSOMAL GENES

isolate chromosomal DNA, use engineered transposon, transform mutated DNA into organism, select for tn mutants generated by HR (transposon has ori)

limitations to in vitro transposon mutagenesis of CHROMOSOMAL GENES

target organism must be competent

most transposon insertions are

polar

WT transposons produce _______ proteins when induced. A lacA transposon insertion mutant produces _______ proteins

3, 2

a lacY transposon insertion mutant produces ______ proteins, a lacZ transposon insertion mutant produces _________ proteins

1, 0

ways to map the site of a transposon insertion on a mutant plasmid

restriction mapping, sequencing (RM is faster)

restriction enzymes are used to ________, they can be used for

digest a purified plasmid, bacterial defense/cutting DNA at sites

relative position of restriction sites is determined by

gel electrophoresis

restriction endonucleases/enzymes recognize

palindrome sequences (ecoRI methylates at A, BamHI methylates at C)

gel electrophoresis separates DNA fragments by _____, the DNA are ____ charged

size, negatively

hisA21 hisB84 would be an example of a

genotype

His+ would be an example of a

phenotype

hisA would be an example of a

WT gene

HisA would be an example of a

WT protein

HisA21 would be an example of a

mutant protein

A nonsense mutation results in ______ .

a truncated protein product

The primary approach that Jacob and Monod employed to figure out how the lactose regulation works in E. coli was _______.

microbial genetics

Which of the following mutations can likely be suppressed by a tRNA mutation?

a nonsense mutation

Two base pairs in DNA are shown in the picture below . Their upper and lower sides are labeled A, A' and B, B', respectively, and the arrows indicate links to the backbone. Which sides of these base pairs are facing the minor groove?

B and B'

what does the 5' and 3' ends of a newly synthesized DNA strand have

5' has a phosphate group and 3' has a hydroxyl group

examples of cis acting elements

oriC, DUE (DNA unwinding element), terA

examples of trans acting elements

dnaA, dnaB

During the normal progress of chromosomal replication in E. coli, _____ different strands of DNA are being extended simultaneously.

4

The priming loop in the trombone model of DNA replication is largest when ____.

a new okazaki fragment is nearly complete

Below is the DNA sequence for part of a gene. The lower strand is the coding (sense or +) strand. Which of the following would be the sequences of the RNA synthesized from this DNA segment?

5' GGTTCCAAGATC 3'

3' CCAAGGTTCTAG 5'

3' CCAAGGUUCUAG 5' (RNA synthesized from coding strand is same as coding strand except the T's are U's)

the coding strand is aka

the sense strand, the plus strand

Which component of a bacterial RNA polymerase directly contacts and recognizes a promoter?

σ (sigma)

if methyl-directed mismatch repair is disabled in E. coli, the error rate of its chromosomal replication is about _____

10^-7

the cultures of a dnaA and a dnaB temperature sensitive (ts) mutants were shifted to their non-permissive temperature along with that of a wild-type (WT) strain. The DNA content of their cultures was analyzed before and after the temperature shift. In the graph below, curves___, ___ and ___ represent the cultures of WT, dnaA and dnaB mutants, respectively.

c is WT, b is dnaA, a is dnaB (dnaB mutants immediately have no more DNA once temp changes)

Which of the following codons is recognized by the initiator tRNA?

Which of the following codons is recognized by the initiator tRNA?

AUG

Generally speaking, a polycistronic mRNA is one that has multiple _______.

non overlapping open reading frames (ORF)

A Shine-Dalgarno sequence base pairs with the translation initiation region of an mRNA.

FALSE, they pair with an rRNA

more examples of cis acting elements

rho termination site, shine-delgarno sequence, rho utilization site (rut), stop codon

more examples of trans acting elements

tRNA suppressor

The primary approach that Jacob and Monod took to study how the lac operon was regulated in E. coli was _______.

forward genetics

Two base pairs in DNA are shown in the picture below. Their upper and lower sides are labeled A, A' and B, B', respectively, and the arrows indicate links to the backbone. Which sides of these base pairs are facing the MAJOR groove?

A and A'

Assuming the primer for DNA synthesis is 5'AGUCGA 3'. If the next nucleotide added to this primer for DNA biosynthesis corresponds to a cytidine (C) on the template strand, what is the correct product?

5'AGUCGAG 3'

The nucleic acids in the priming loop in the Trombone Model of DNA replication contains______.

RNA as well as single and double stranded DNA

what is the function of DNA polymerase III

synthesizes the bulk of DNA

what is the function of initiator protein dnaA

binds to the origin of replication

what is the function of dnaB helicase

unwinds DNA to advance the replication fork

what is the function of DNA ligase

covalently links DNA strands

what is the function of primase dnaG

synthesizes RNA

what is the function of RNaseH

removes primer

Which of the following contains a sequence recognized by the E. coli Dam methylation system?

GGATCC (Dam methylates adenine within a GATC sequence)

The processes of copying/transferring the information from DNA to DNA, from DNA to RNA and from RNA to protein synthesis are known as _____, _____, and _____, respectively.

replication, transcription, translation

If an RNA molecule is able to catalyze an chemical reaction in a cell, this RNA is known as a(n) ____.

ribozyme

Which of the following sense (+) strand of DNA likely specifies an intrinsic transcriptional terminator?

CCCCCCCAAAATCCCCCCCTTTTTTTTTTT

GGGGGGGAAAATCCCCCCCAAAAAAAAAAA

GGGGGGGAAAATGGGGGGGAAAAAAAAAAA

GGGGGGGAGGGTCCCCCCCATATATATATA

GGGGGGGAAAATCCCCCCCTTTTTTTTTTT

GGGGGGGAAAATCCCCCCCTTTTTTTTTTT

The cis-acting element that specifies the start and direction of transcription is known as a ____.

promoter

The strength of a promoter refers to its ability to ________.

promote the rate of transcription initiation

The bacterial transcription elongation complex contains _____.

the RNA polymerase holoenzyme

Which component of a bacterial RNA polymerase has the primary role in recognizing a promoter for transcription?

σ (sigma)

During abortive transcription initiation, which of the following is released?

a short transcript

Which of the following is considered the "translator" or "interpreter" of genetic codes into a protein sequence?

tRNA

Which of the following amino acid is carried by the initiator tRNA?

formylmethionine

Which of the following three codons more likely specify the same amino acid?

AUU, AGU, ACU

GUA, CUA, UUA

GGU, GGC, GGG

AUU, GUU, CUU

GGG, CGG, UGG

GGU, GGC, GGG

The following is a 2D depiction of a tRNA with different parts of the molecule labeled by A, B, C, D and E. Which part carries an amino acid during protein synthesis?

A

Below is the sequence of a stretch of double-stranded DNA. Which frame is possibly in the middle of an ORF?

GTTAACTAGCTACTCGCC

CAATTGATCGATGAGCGG

+2

Generally speaking, a polycistronic mRNA is one that has _______.

multiple open reading frames (ORFs) for proteins

The Shine-Dalgarno (S/D) sequence in a translation initiation region (TIR) basepairs with _________.

16S rRNA

Rho factor binds to ______ to facilitate ________.

mRNA, transcription termination

A nonsense tRNA suppressor is an intragenic suppressor that has pleiotropic effects.

FALSE

if a mutation in a gene can be suppressed by an amber tRNA suppressor, it must be a(n)____ mutation and the final gene product in question is a(n) ____.

nonsense, protein

Generally speaking, what are the three different categories of research activities conducted by a microbial geneticist?

look later

) Name two different mechanisms by which a nonsense mutation can be polar in bacteria, and 2) briefly explain how each works to result in a polar effect.

look later

In the genetics experiments with peas conducted by Mendel, the seeds in the F2 generation showed combinations of coloration and shape unseen in their parents. The primary reason for this observation is _______.

sexual reproduction and genetic mixing

some more cis acting elements

oriV, oriT, oriC, terA

another trans acting element

recA

Assume the reversion rate for a single marker in a Thr- Leu- Thi- Bio+ Phe+ Cys+ E. coli strain is 10-7. Without genetic exchange, the frequency at which the strain can become Thr+ Leu+ Thi- Bio+ Phe+ Cys+ and Thr+ Leu+ Thi+ Bio+ Phe+ Cys+ are _____ and ____, respectively.

A. 10-6 /10-7

B. 10-7 /10-14

C. 10-14 /10-21

D. 10-21 /10-28

E. 10-7 /10-49

10^ -14, 10^-21

An Hfr strain (thr+ leu+ met¯ mal+ rpsL¯) is mated with an F¯ strain (thr¯ leu¯ met+ mal¯ rpsl+). After mating, Thr+ Leu+ and Met+ transcojugates are selected. Which of the following phenotypes is most likely for the two unselected markers in the transconjugates? (These genes here are not closely linked).

A. MalO RpsLO

B. Mal+ RpsL+

C. Mal¯ RpsL¯

D. Mal¯ RpsL+

E. Mal+ RpsL¯

Mal¯ RpsL+

what is transduction

DNA transfer mediated by phage

what is transformation

uptake of free DNA

what is competence

ABILITY to take up free DNA

what is a transducing phage particle

a phage particle that contains host DNA

what is a transductant

progeny from a cross mediated by phage

Production of transducing phage particles requires ______ whereas a specialized transduction necessitates _________.

a lytic infection cycle, a lysogenic infection cycle

During its replication cycle, T4 DNA is produced as individual chromosomes and packed by the assembly T4 proteins around the chromosome.

FALSE

A null mutation is dominant while a gain-of-function mutation is recessive to their wild-type allele.

FALSE

If two his- mutations complement each other in a complementation test, they are in ____ complementation group(s) and likely occurred in ______ gene(s).

different, different

To enrich for Lac- mutants, one may incubate mutagenized cells____ before plating.

In the presence of ampicillin and lactose

Which of the following did NOT contribute directly to discredit enzyme adaptation as an explanation for lactose induction of beta-galactosidase?

Some lacZ mutant is unable to grow with lactose as the sole carbon and energy source

Some substrates are not good inducers

Some good inducers are not substrates

Beta-galactosidase appears synthesized de novo, ie, the protein did not pre-exist before induction

Some lacZ mutants produced defective beta-galactosidase

Some lacZ mutant is unable to grow with lactose as the sole carbon and energy source

How was the lactose permease discovered?

There were Lac- mutants that produced active beta-galactosidase

Allolactose but not lactose is the true inducer of lac gene expression when lactose is provided to E. coli.

true

What is the phenotype of a mutant with lacZ+ lacY1-/F' lacZ+ lacY2- genotype?

Lac¯, inducible for β-galactosidase and noninducible for the permease

From a merodiploid strain for the lac region (genotype: lacI+ lacP+ lacO+ lacZ+ lacY+/ F′ lacI+ lacP+ lacO+ lacZ+ lacY+), you managed to isolate a spontaneous mutant that constitutively expressed β-galactosidase. Which of the following is likely the mutation in this mutant?

A. lacI¯

B. lacIS

C. lacOC

D. lacZ¯

E. lacP¯

lacOC

From a lacIs mutant, you managed to identify a spontaneous Lac+ mutant , which of the following might be the mutation?

A. lacI-

B. lacOC

C. lacZ

D. lacY

E. both A & B

both A & B (lacI- and lacOc)

In the gene removal experiment using conjugation, genes were removed ____.

by radio-active labeling of donor DNA in mating.

What is the phenotype of an coli strain with the lacP¯ lacZ+ lacY¯/ F′ lacP+ lacZ¯ lacY+ genotype?

Lac¯, noninducible for β-galactosidase and inducible for the permease

Lederberg and Tatum discovered bacterial conjugation or mating ____.

By mixing two different E. coli strains and selecting for recombinants

In the initial publication describing the discovery of bacterial conjugation, the authors (Lederberg & Tatum) determined that it was not transformation by ____.

killing one of the strains

If the cultures of two genetically stable bacterial strains with different phenotypes are mixed and cells with recombinant phenotypes readily appear, this likely indicate _____

mixing of genetic materials and recombination