Bio 102 Exam All Terms

DNA

Deoxyribonucleic acid, stores genetic information

DNA's Purpose

As the instruction code for making proteins

DNA Composition

Two long chains made of Nucleotides

Nucleic Acid Composition

Composed of 3 parts

1. A deoxyribose sugar
2. A Phosphate molecule
3. A Nitrogenous base

Names of Nitrogenous Bases (4 Types)

Adenine
Guanine
Cytosine
Thymine

DNA Structure

Two strands (double) that are twisted into a spiral shape (helix)

Since DNA is double-stranded…

Nucleotides can only bond to one other nucleotide on the other strand
*Bases meet in the middle

Chargaff's Rule of Base Pairing

A bonds with T (A=T)
C bonds with G (C=G)

The Double Strand has a…

Strong "Backbone" on each side
*Doesn't come apart
Weak base connections in the center
*Allows for the access of genetic code

All enzymes required in DNA replication

DNA Helicase

• Unwinds the Helix by breaking hydrogen bonds
  DNA Polymerase
• Moves along both DNA strands, proofreads the the strands and fixes mistakes at the end
  DNA Ligase
• Fills gaps, ensures backbones are solid

Protein Synthesis

The process of "making proteins"

The Central Dogma

A theory stating that genetic information only flows in one direction, from DNA to RNA, to protein

DNA is stored in the…

Nucleus

Proteins are made in…

Cytoplasm

Why does DNA need RNA?

DNA will be destroyed by lysosomes if it leaves the Nucleus
DNA is Double-stranded (Won't fit through nuclear pores)
DNA is too long, and there is a lot of it

RNA Composition

Single Stranded

• Will fit through nuclear pores
  Shard Sequence
• Only one DNA gene is converted to RNA at a time
  Contains all the same bases as DNA, except Thymine (T)
• Instead there is Uracil (U)
  Sugar = Ribose
• Not "Deoxyribose" like in DNA

What are the types of RNA? (3 Types)

Messenger (mRNA)

• The genetic code
  Ribosomal (rRNA)
• Folds in on itself to make a ribosome
  Transfer (tRNA)
• A sequence of RNA that can bind to one type of amino acid and transfer it to the ribosome.

What are the major processes in Protein Synthesis? (2 Processes)

Transcription (DNA or mRNA)

• Occurs in the Nucleus
• Requires RNA Polymerase
  Translation (mRNA to amino acids)
• Occurs in the cytoplasm or ER
• Requires a Ribosome
  *Each has a post-process

What are the post-processes in Protein Synthesis? (2 Processes)

Post-Transcriptional Modification

• mRNA is spliced
• Transcripts are finished with a modified guanine cap and a "Poly-A" tail
• Both modifications protect the mRNA once it leaves the safe of the nucleus.
  Post-Translational Protein Folding
• The finished polypeptide chain folds into a unique protein

Practice: Translate this DNA sequence into mRNA
TACAAGTGGATGTCTAGATTCGAGTGGGGTGAGCTTCAAACT
Hint: Remember Chargaff's Rule of Base Pairing

AUGUUCACCUACAGAUCUAAGCUCACCCCACUCGAAGUUUGA

Practice: Translate this mRNA sequence into an Amino Acid Chain
AUGCAGUCAGUUACUACUUUACGACUUUGA
Hint: Use the given table to translate

MET GLN SER VAL THR THR LEU ARG LEU STOP

Mutation

Any change to DNA

What are causes of Mutations? (2 Types)

Polymerase Errors

• DNA Polymerase could cause in error during replication
• RNA Polymerase could cause an error during transcription
  Mutagens
• Things in the environment that damage DNA

What are the categories of Mutations? (2 Types)

Chromosomal Mutations

• Large-scale mutations involved entire sections of chromosomes (multiple genes)
  Gene Mutations (AKA Point Mutations)
• Small-scale mutations involving base changes of single genes

Types of Gene Mutation (3 Types)

Substitution

• One Nucleotide is changed to a different one
  Insertion
• A nucleotide is added into the Original Sequence
  Deletion
• A nucleotide is deleted from the Original Sequence

What are effects of Substitution in Gene Mutation (3 Effects)

Silent Mutation

• Mutated codon results in the same amino acid. Does Not affect protein
  Nonsense Mutation
• Mutated codon is a STOP codon, Protein not fully made.
  Missense Mutation
• Mutated codon results in a different amino acid. May or may not affect the protein

What is an Effect of Insertion or Deletion?

Frameshift

• Moves nucleotides over one spot
• Divisions of 3 are inaccurate
  *All codons are affected downstream of the mutation

What does the shape of a protein depend on?

The order of Amino Acids

Primary Structure

The unique amino acid sequence of a protein

Secondary Structure

The polypeptide chain folds and forms hydrogen bonds between amino acids

Tertiary Structure

A secondary structure is compacted into structurally stable units called domains
*Forms a functional protein

Quaternary Structure

Some proteins consist of two or more folded polypeptide chains in close association

Polar Amino Acids

Hydrophilic (Water Loving) molecules
*On the outside of the protein

Nonpolar Amino Acids

Hydrophobic (water fearing) amino acids
*On the inside of the protein

Disulfide Bonds

Cyestine is an amino acid with the atom Sulfur in it

Two Sulfur atoms will bond to form "Disulfide bonds"
*Links many proteins together, i.e. insulin

Neutral Mutations

No Noticeable effect, or one that is barely noticeable

• Makes up most mutations

Beneficial Mutations

Resulting in new versions of proteins that are better than those before

Harmful Mutations

Cause proteins to not function correctly, and influence the survival of the organism

Cell Differentiation

Each cell contains the full DNA code, but not every cell is the same

Differentiation

The process by which cells become specialized for different jobs

When does Differentiation happen?

Embryonic Development

Gene Regulation

Cellular differentiation is accomplished through gene regulation

• Genes have promoter regions in front of them
• Regulatory proteins bind to promoters to either block the gene or speed up how fast it's read

Gene Regulation During Development

Some genes are permanently turned off (Silenced) because they are becoming specialized.

Gene Regulation Throughout Life

Some genes are left "open" and can be regulated throughout the organism's life, depending on its needs.

Stem Cells

Unspecialized cells from which different cells develop

Totipotent Cells

Cells capable of developing into any cell type
*All genes are Available

Pluripotent Cells

Capable of developing into any cell of a particular tissue type

Multipotent Cells

Can produce many types of differentiated cells within the same organ tissue type

How do prokaryotes do cellular reproduction?

Prokaryotes are unicellular and reproduce asexually by a simple cell division, called binary fission

How is DNA prepared to divide during cell division?

Chromatin is wound up into a tightly coiled structure called a chromosome

Chromosome

One long DNA strand that is wrapped around proteins (histones) and condensed

Nucleosomes

A histone with DNA wrapped around it, the smallest unit of structural organization in chromosomes

Chromosome Composition

Two identical sides

• Each half is called a sister chromatid
• The sisters are held together by a centromere

Cells in multi-cellular organisms divide for what reasons? (5 reasons)

1. To make specialized cells for each body part
2. Growth of the organism
3. Replace worn out or damaged cells
4. Make reproductive cells
5. To ensure cells stay small

Why do cells stay small?

Cells stay small because the membrane is only two molecules thick, whilst retaining high surface area
*As cells get bigger, the strain on the cell membrane increases (i.e. a bursting balloon)

Surface Area effects

A high surface area allows more nutrients through a cell.

A low volume to allow for small molecules to go all the way through the cell

*Ultimately helps the cells transport molecules quickly

Cell Cycle (3 Stages)

• Interphase
• Mitosis
• Cytoplasmic Division

Interphase (3 Stages)

Consists of 3 stages

• G1: The cell grows and carries on normal functions
• S: The DNA in the cell replicates (DNA Synthesis)
• G2: The cell prepares for division

Stages of Mitosis (4 Stages)

Prophase

• Chromosomes condense, nuclear envelope breaks up
  Metaphase
• Sister chromatids line up in the middle, Ensures that one of each chromatid will go into each new cell
  Anaphase
• Sister chromatids separate and are pulled to opposite ends
  Telophase
• A new nuclear envelope forms around each cluster of chromatids

Growth Factors

External signals that can activate kinases to start mitosis

Cyclins & Kinases (action)

Proteins that can activate other molecules to start or stop the cell cycle

What happens when checkpoint mechanisms fail?

A cell loses control over its cell cycle, and may form a tumor (abnormal mass of cells)

Checkpoint mechanisms fail because of…

A mutation in one or more checkpoint gene products

• Tumor suppressor gene
  *produce kinases that inhibit mitosis
• Proto-oncogenes
  *produce transcription factors that stimulate mitosis

Types of Tumors (2 Types)

Benign Tumors

• Have not spread, more easily treatable
  Malignant Tumors
• Metastasize (spread) to other parts of the body. Harder to treat.

Causes of Cancer (3 Causes)

Genetics

• Some people inherit a higher susceptibility to mutations that cause cancer
  Environmental Carcinogens
• Substances or energies that lead to mutation
  Old age & Immune System
• White blood cells decline as we age, weakening our ability to fight cancer

Cancer Treatment (3 Stages)

1. Usually removal of the tumor

2. Radiation Therapy

• X-rays or Gamma rays applied to tumor
• Damages cancerous cells' DNA and prevents further division

1. Chemotherapy

• Chemicals target and kill rapidly dividing cells
  *Including stomach, skin, and hair cells

Karyotype

An image of a person's DNA wrapped into chromosomes.

Which spot contains the chromosome determining sex?

Spot 23 contains genes related to the person's biological sex.

What are body cells called?

Somatic Cells

What are Autosomal chromosomes?

Non-sex chromosomes (1-22)

What are Gamete Cells?

Reproductive Cells (Sperm & Eggs)
Contain half as many chromosomes as somatic cells
Also called Haploid Cells

What happens when two Haploid cells join during Fertilization?

The chromosome number is restored.
AKA Diploid Cells

Diploid () Haploid ()
*How many sets of chromosomes does each cell type have? (in terms of n)

Diploid (2n)
Haploid (n)

Find the Diploid number for each Adult:
Human: n=23 : ___
Onion: n=8 : ___
Cow: n=30 : ___

Human: 46
Onion: 16
Cow: 60

Haploid or Diploid Transitions:

Mitosis: Diploid →
Meiosis: Diploid →
Fertilization: Haploid → _

Mitosis: Diploid → Diploid (2n → 2n)
*Number doesn't change due to DNA replication
Meiosis: Diploid → Haploid (2n → n)
*Cuts chromosome number in half for gamete production Fertilization: Haploid → Diploid (n → 2n)
*Sperm and Egg fuse to create full set of chromosomes in offspring

What is Sexual Reproduction?

One set of DNA from the mother and one from the father join together.

Name these 3 Chromosome types

Chromatid, Sister Chromatids, Homologous Chromosomes

What are Homologous Chromosomes?

Carriers of same variations of genes, either being from the Mother or Father (for traits)
*Ex. Eye Color

What are the 3 Stages of Meiosis?

Interphase, Meiosis 1, Meiosis 2

What happens during Interphase in Meiosis?

DNA is replicated to form sister chromatids

What happens during Meiosis 1 in Meiosis?

Homologous Chromosomes separate

What happens during Meiosis 2 in Meiosis?

Sister Chromatids separate

An trait tends to spread more through a sexually reproducing population than through an asexually reproducing one.

An Adaptive trait tends to spread more quickly
through a sexually reproducing population than through an asexually reproducing one.

Asexual reproduction produces genetically of a parent

Asexual reproduction produces genetically identical copies of a parent
*Clones

What is Random Assortment?

Chromosomes go into different cells randomly

What is "Crossing Over"?

Homologous Chromosomes swap genes during Prophase 1.

What are the 3 Errors of Meiosis?

Situations where the chromosomes fail to separate during Meiosis
Gametes potentially ending up with an uneven number of chromosomes
Fertilization with these gametes leads to offspring with extra or missing chromosomes

What is Heredity?

The way genetic information is passed from parents to offspring.

What is a Gene?

A section of DNA that codes for a single trait.

What is an Allele?

A version of a gene.
Ex.
Gene: Eye Color
Allele: Blue, Green, Hazel, Brown

What makes an Allele Dominant?

If the effect masks the effect of a recessive allele paired with it, it is Dominant.

Homozygous - Alleles for a Trait
Heterozygous - Alleles for a Trait

Homozygous - Same Alleles for a Trait
Heterozygous - Different Alleles for a Trait

What is a Genotype?

Direct genetic Make-up (Alleles)

What is a Phenotype?

The physical trait (Appearance)

What is a Pedigree?

A chart that shows how individuals are related, and shows how traits are passed down in a family.

Write as much as possible about the Circled Individual
Tracked Trait is Freckles (Dominant)

Female, Homozygous Recessive, Youngest Sibling

What is the Law of Segregation?

Alleles for the same gene that separate during Meiosis

What is Mendel's Parent (P) Generation?

When Mendel crossed two homozygous plants.
(One Dominant, One Recessive)

What was Mendel's F1 Generation?

The product of the Parent generation, where all plants were Heterozygous.

What was Mendel's F2 Generation?

When Mendel crossed two plants from the (heterozygous) F1 Generation, producing a single single Recessive Phenotype (White).