Molecular Biology Practice Problems - Exam 1

Which of the following is FALSE about nucleosome positioning?

a. A nucleosome can be deposited at a particular DNA region

b. translational positioning determines which regions of DNA are in the core DNA

c. rotational positioning determines which side of DNA is exposed

d, it plays role in determining which proteins bind to DNA

e. none of the above

none of the above

which of the following is TRUE about nucleosome?

a. it contributes to DNA condensation

b. linker histone H1 is necessary for the formation of 30 nm fiber

c. DNA in a nucleosome is divided into core DNA and linker DNA

d. posttranslational modifications are crucial for the function of nucleosomes

e. all of the above

all of the above

core histones have c-terminal traits composed of amino acids that are targets for various chemical modifications. which amino acid is subject to acetylation?

lysine

in addition ot core histones, histone variants contributes to the formations of nucleosomes. which of the following is FALSE about histone variants?

a. they carry out different functions

b. histone H3 is replaced with a variant during the first round of transcription

c. c-terminal sequences of histone H3 variants are substantially different from that of histone H3.

d. all of the above

e. none of the above

none of the above

What is the sequence complementary to the following DNA?

5’- TTCGAATGCCATTAAACTGAAGT -3’

5’- ACTTCAGTTTAATGGCATTCGAA -3’

which of the following is FALSE about the DNA base pairing?

a. thymine can base pair with adenine and uracil

b. a G-C pair is stronger than an A-T pair

c. it is important for the function and maintenance of DNA double repair

d. purines always base pair with pyrimidines

e. none of the above

thymine can base pair with adenine and uracil

the following is a part of mRNA sequence. what is the sequence of template DNA for this RNA?

5’- AUUGACGA -3’

5’- TCGTCAAT -3’

__ is the process by which a single-stranded DNA is synthesized using RNA as the template.

reverse transcription

a student isolated a circular plasmid DNA from e.coli. this DNA was 4,000 base pairs, and its linking number (Lk) was 380. which of the following is false?

a. it is supercoiled

b. it is underwound compared to the relaxed B form

c. the linking number difference (ΔLk) is greater than 0

d. it is negatively supercoiled

e. it is more compact than the relaxed DNA

the linking number difference (ΔLk) is greater than 0

what is the difference between chromatin and chromosome?

a. they are different in supercoiling status

b. they have different DNA sequences

c. there is no difference

d. chromosomes is the substrate for DNA replication

e. chromatin is the ideal form for genome segregation during mitosis

they are different in supercoiling status

what is the name of the DNA element responsible for equal segregation of the duplicated genome?

centromere

which of the following is FALSE about the bacterial genome?

a. it is composed of euchromatin and heterochromatin

b. RNAs and proteins are necessary to maintain the nucleoid

c. it is divided into a numerous domains that are topologically independent from each other

d. supercoiling is crucial for the formulation and maintenance of the nucleoid

e. none of the above

it is composed of euchromatin and heterochromatin

which of the following is FALSE about telomere and telomerase?

a. the telomerase complex is responsible for the maintenance of telomere length

b. telomere prevents the linear DNA ends from getting recognized by DNA repair systems

c. telomerase has the reverse transcriptase activity

d. the telomere has a single-stranded region with the 5’- end (i.e. 5’- overhang)

e. telomeres are composed of short sequences that are repeated many times

the telomere has a single-stranded region with the 5’- end (i.e. 5’- overhang)

in eukaryotes, origins of replication are bound to origin recognition complex (ORC). however, ORC is unable to activate the origin of replication without these factors. what is the term referring to a collection of proteins that are necessary to activate the origin of replication?

licensing factors

a DNA unit that replicates from one origin of replication is called

replicon

which of the following is FALSE about the origin of replication in e. coli?

a. it creates two replication forks

b. it contains multiple GATC sequences that are subject to methylation on adenine

c. hemimethylated oriC cannot initiate the DNA replication

d. only one origin of replication is present in e. coli

e. none of the above

none of the above

which of the following is FALSE about origins of replication in eukaryotes?

a. they are associated with the origin recognition complexes throughout the cell cycle

b. each human chromosomes has many origins of replication

c. all origins of replication are activated simultaneously in human cells

d. all of the above

e. none of the above

all origins of replication are activated simultaneously in human cells

which of the following is FALSE about licensing factors?

a. they are required for the activation of origins of replication

b. some licensing factors are degraded immediately after activating origins of replication

c. some licensing factors are regulated by post-translational modifications

d. all of the above

e. none of the above

none of the above

which DNA polymerase is responsible for replicating the genome in e. coli?

DNA polymerase III

a molecule that provides -OH group for DNA synthesis is called a primer. which of the following can be a primer?

a. short RNA synthesized by primase

b. transfer RNA (tRNA)

c. protein containing serine or threonine residues

d. all of the above

e. none of the above

all of the above

e. coli replisome includes core enzyme, sliding clamp, clamp loader, and tau subunit. which of the following subunit in core enzyme is responsible for DNA synthesis?

α subunit

e. coli replicase has the extremely low error rate owing to its proofreading activity. which subunit provides this function?

ε subunit

which of the following is involved in DNA replication in eukaryotes?

a. DNA polymerase α

b. DNA polymerase δ

c. DNA polymerase ε

d. MCM complex

e. all of the above

all of the above

what is the common function of DnaG and DNA polymerase α?

they synthesize RNA primer