1/309
Looks like no tags are added yet.
Name | Mastery | Learn | Test | Matching | Spaced | Call with Kai | Chat |
|---|
No analytics yet
Send a link to your students to track their progress
The liver performs all of the following functions except
A) Blood glucose regulation
B) Processing of foreign molecules
C) Storage of energy in the form of fat
D) Synthesis of plasma protein
E) Synthesis of urea
Storage of energy in the form of fat
During fasting and prolonged starvation, skeletal muscle
A) Protein is degraded to provide amino acids to the liver for gluconeogenesis
B) Released as fat into the blood for storage in adipose tissue
C) Is synthesized from blood lactate
D) Converts glutamine molecules to proline
E) None of the above are correct
Protein is degraded to provide amino acids to the liver for gluconeogenesis
The cells that line the small intestine, which are responsible for the absorption of nutrients into the body, are
called
A) Adipocytes
B) Tubule cells
C) Hepatocytes
D) Enterocytes
E) Epithelial cells
Enterocytes
The functions of the kidney include all of the following except
A) Blood pH regulation
B) Body water regulation
C) Reabsorption of electrolytes, sugars, and amino acids from the urinary filtrate
D) Filtration of blood plasma which results in the excretion of water-soluble waste products
E) Production of urea from ammonia
Production of urea from ammonia
The most distinctive characteristic of living organisms is
A) Cellular structure
B) The autonomous capacity to sustain adequate operating conditions
C) Utilization of carbon compounds as food
D) Complex cellular mechanisms
E) Utilizing environmental materials as energy sources
The autonomous capacity to sustain adequate operating conditions
A simple system for information flow is composed of three components : reception, transduction and
response. In multicellular organisms hormones play a role in which phase?
A) Reception
B) Transduction
C) Response
D) Hormones are not involved in the process of information flow
E) Both A and B are correct
Reception
In a metabolic steady state the rate of anabolic processes is approximately equal to:
A) Catabolic processes
B) Cellular energy needs
C) Nutrient intake
D) Cellular repair and growth
E) B and C
Catabolic processes
In animals the vast majority of water-soluble hormones are
A) Peptides
B) Steroids
C) Polypeptides
D) Carbohydrates
E) A and C
A and C
The molecules that mediate the growth-promoting actions of GH are referred to as the
A) Interferons
B) Mitogens
C) Insulin-like growth factors
D) Both B and C are correct
E) None of the above are correct
Both B and C are correct
Symptoms of uncontrolled diabetes mellitus include all of the following except
A) Hyperosmolar hyperglycemic nonketosis
B) Hypoglycemia
C) Hyperlipoproteinemia
D) Ketoacidosis
E) Polyuria
Hypoglycemia
Steroid hormones
A) Are transported in blood attached to transport proteins
B) Bind to intracellular receptors
C) Diffuse through the plasma membrane of target cells
D) Both A and B are correct
E) All of the above are correct
All of the above are correct
Which of the following is not a major source of extracellular signal molecules?
A) Steroids
B) Modified amino acids
C) Carbohydrates
D) Fatty acids
E) Proteins
Carbohydrates
The biological effects of atrial natriuretic factor appear to be mediated by ______.
A) cAMP
B) cGMP
C) PIP 2
D) AG
E) IP 3
cGMP
In animals the ______ system has a primary responsibility for co-ordinating metabolism.
A) Nervous
B) Lymphatic
C) Hepatic
D) Endocrine
E) A and D
A and D
The IP 3 receptor
A) Binds cGMP
B) Is associated with G i
C) Is a calcium channel
D) Both B and C are correct
E) All of the above are correct
Is a calcium channel
A DNA segment that binds a hormone-receptor complex is called a _________.
A) DRE
B) DAG
C) EGF
D) HRE
E) IGF
HRE
Calmodulin is a
A) Transmembrane receptor
B) Calcium-binding protein
C) HSP
D) Plant hormone
E) A, B and C are correct
Calcium-binding protein
Insulin resistance is
A) A risk factor for Type I diabetes
B) A risk factor for Type II diabetes
C) Caused by excessive production of ANF
D) Associated with damage to the adrenal gland
E) None of the above are correct
A risk factor for Type II diabetes
Receptors for most water soluble hormones are located in what part of the cell?
A) Plasma membrane
B) Endoplasmic reticulum
C) Nucleus
D) Cytoplasm
E) Nuclear membrane
Plasma membrane
The most prominent mechanism to prevent excessive hormone syntheis is
A) Desensitization
B) Downregulation
C) Feedback inhibition
D) Target cell stimulation
E) Sensitization
Feedback inhibition
Enterocytes require large amounts of energy supplied by
A) Glucose oxidase
B) Fatty acid degradation
C) Lactose oxidation
D) Glutamine
E) Alanine
Glutamine
The organ responsible for processing most foreign molecules is
A) Intestine
B) Stomach
C) Liver
D) Kidney
E) Blood
Liver
Insulin-resistance is associated with all of the following except _______.
A) Obesity
B) Desensitizatioin
C) Down-regulation
D) IDDM
E) NIDDM
IDDM
Biochemical signal molecules include _________
A) Amino acids
B) Fatty acid derivatives
C) Steroids
D) Peptides
E) All of the above are true
All of the above are true
Receptor tyrosine kinases are transmembrane receptors that bind ligands such as
A) Insulin
B) Epidermal growth factor
C) Platelet derived growth factor
D) Insulin like growth factor
E) All of the above
All of the above
Which of the following molecules is a second messenger?
A) TSH
B) cGMP
C) Proline
D) Calcium
E) Both B and D are correct
Both B and D are correct
The organ responsible for the regulation of blood pH is
A) Liver
B) Kidney
C) Intestine
D) Brain
E) Stomach
Kidney
Most diabetic complications are the result of
A) Glycation
B) Hyperglycemia
C) Damage to the vascular system
D) Both A and B are correct
E) All of the above are correct
All of the above are correct
The principle target tissues of insulin include
A) Skeletal muscle
B) Liver
C) Adipose tissue
D) Both B and C are correct
E) All of the above are correct
All of the above are correct
Animals employing several mechanisms to prevent excessive hormone action and release. Examples include
which of the following?
A) Genetic regulation
B) Feedback inhibition
C) Desensitization
D) Down regulation
E) All of the above are true
All of the above are true
Which of the following molecules do GPCRs not respond to?
A) Catecholamines
B) Oxytocin
C) Light
D) Dopamine
E) Insulin
Insulin
Which of the following is a role of PKB?
A) Stimulation of glycogen synthesis
B) Inhibition of lipolysis
C) Glucose transport into adipocytes
D) Activation of mTOR
E) All of the above are roles of PKB
All of the above are roles of PKB
An example of a cytokine is
A) Epidermal growth factor
B) Interleukins
C) Interferons
D) Insulin-like growth factors
E) B and C
B and C
The most serious acute symptom of type 1 diabetes is
A) Anemia
B) Ketoacidosis
C) Hypoglycemia
D) Insulin resistance
E) Both A and C are correct
Ketoacidosis
Hyperosmolar hyperglycemic non-ketosis can occur in type _____ Diabetes
A) Type I
B) Type II
C) Insulin dependent diabetes
D) Is present in all forms of diabetes
E) Is not a symptom of diabetes
Type II
During periods of starvation muscle reduces its consumption of glucose. This spares its use for which of the
following organs?
A) Liver
B) Heart
C) Kidneys
D) Brain
E) Lungs
Brain
Leptin is secreted by which of the following tissues?
A) Brain
B) Liver
C) Adipose tissue
D) Muscle
E) Gasterintestinal tract
Adipose tissue
The brain consumes about _______% of the body's energy.
A) 10
B) 20
C) 30
D) 40
E) 50
20
The phosphatidylinositol cycle mediates the action of all of the following except ______.
A) Acetylcholine
B) Insulin
C) Glucagon
D) Vasopressin
E) GRH
Glucagon
Metabolism of fructose in the liver rapidly depletes which of the following
A) NADPH
B) ATP
C) Triose phosphate
D) AMP
E) Glucose
ATP
An autoimmune disease caused by the destruction of the insulin producing beta cells of the pancreas is
called
A) Hyperglycemia
B) Dyslipidemia
C) Glucosuria
D) Type II diabetes
E) Type I diabetes
Type I diabetes
Extreme thirst and frequent urination in diabetics is directly caused by
A) Osmotic diuresis
B) Hyperglycemia
C) Dyslipidemia
D) Glucosuria
E) Adipoisledimia
Glucosuria
Type II diabetes is uniquely characterized by:
A) Hyperinsulinemia
B) Depressed insulin levels
C) Insulin resistance
D) Depressed glucose levels
E) A and C
A and C
Which of the following carbohydrates is a major contributing cause of dyslipidemia non-alcoholic fatty
liver disease?
A) Glucose
B) Ribose
C) Fructose
D) Galactose
E) Xylose
Fructose
Urea synthesis is the responsibility of which organ of the body?
A) Kidney
B) Liver
C) Intestine
D) Stomach
E) Lung
Liver
There are approximately _________ human genes.
a. 10,000
b. 20,000
c. 100,000
d. 1,000,000
e. 10,000,000
20,000
______ are gene sequences that code for a gene product.
a. Introns
b. Exons
c. Nucleosomes
d. Cruciforms
e. Snurps
Exons
A genome is
a. The sequence that contains the base sequence information necessary to code for a gene product
b. The complete DNA base sequence in an organism
c. The complementary pairing of purine and pyrimidine bases
d. A base pair
e. A newly synthesized RNA molecule
The complete DNA base sequence in an organism
Protein synthesis is called
a. Translation
b. Transcription
c. Replication
d. A metabolome
e. Proteone
Translation
The entire set of proteins synthesized by a cell is called
a. Metabolome
b. Genome
c. Proteome
d. Epigenome
e. Transcriptome
Proteome
The polyamines assist in the compression of eukaryotic chromosome structure because they
a. Contain functional groups that bond to DNA
b. Assist in the formation of telomeres
c. Possess positive charges that interact with the negative charges of DNA
d. Promote chemical modification of the histones
e. None of the above are correct
Possess positive charges that interact with the negative charges of DNA
In nucleosome structure the histone ________ aids in stabilizing the wrapping of DNA around the protein
octomer.
a. H1
b. H2A
c. H2B
d. H3
e. H4
H1
Chromatin contains several levels of structure which include
a. Nucleosomes
b. 200 nm filaments
c. 30 nm fiber
d. Both B and C are correct
e. All of the above are correct
All of the above are correct
D loops and variable loops are found in _______
a. mRna
b. rRNA
c. tRNA
d. hnRNA
e. snRNA
tRNA
Which of the following are involved in the splicing of RNA molecules?
a. Snurps
b. snRNA
c. rRNA
d. Both A and B are correct
e. None of the above are correct
Both A and B are correct
The DNA strand that acts as a template during transcription is referred to as the ______ strand.
a. Sense
b. Antisense
c. Transcribed
d. All of the above are correct
e. None of the above are correct
Antisense
Determine the mRNA sequence for the following DNA sequence 5'-GCCATTTCCCGTTA-3'
a. 5'-CGGTAAAGGGCAAT-3'
b. 5'-CGGUAAAGGGCAA-3'
c. 5'-TAACGGCAAATGGC-3'
d. 5'-UAACGGCAAAUGGC-3'
e. 5'-UAACGGGAAAUGGC-3'
5'-UAACGGGAAAUGGC-3'
During a transition mutation which of the following bases would be substituted for cytosine?
a. Thymine
b. Adenine
c. Guanine
d. Both B and C are correct
e. All of the above are true
Thymine
The polyamines are a class of DNA binding molecules that include ______.
a. Spermine
b. Speruline
c. Spermidine
d. Both A and C are correct
e. All of the above are correct
Both A and C are correct
_______ are structures that occur at the ends of chromosomes
a. Cistrons
b. Telomeres
c. Cruciforms
d. Centromeres
e. Capsids
Telomeres
HIV infection of a susceptible cell is initiated when the gp120 envelope protein binds the _______ antigen
a. T4
b. C4
c. T2
d. C2
e. None of the above are correct
None of the above are correct
HIV is a type of
a. Pox virus
b. Rhabdovirus
c. Herpes virus
d. Papilloma virus
e. Retrovirus
Retrovirus
HIV possesses a ________ genome
a. ssDNA
b. dsDNA
c. ssRNA
d. dsRNA
e. None of the above are correct
ssRNA
Hydroxyapatite
a. Is a calcium phosphate gel
b. Binds to double stranded DNA
c. Is used in column chromatography
d. Both A and C are correct
e. All of the above are correct
All of the above are correct
Southern blotting
a. Is a technique used to identify specific genes
b. Binds to double stranded DNA
c. Is a chain terminating method
d. Both A and B are correct
e. All of the above are correct
Both A and B are correct
The genetic variations observed in DNA fingerprinting are referred to as ______.
a. RFLPSs
b. RLFPs
c. FRLPs
d. DFLPs
e. DLFPs
RFLPSs
The extraction and purification of bacterial DNA involves the use of which of the following.
a. RNase
b. Lysozyme
c. Phenol and chloroform
d. Both A and B are correct
e. All of the above are correct
All of the above are correct
Palindromes
a. Form cruciforms
b. Contain inverted repeats
c. Are sequences that provide the same information whether they are read forward or backwards
d. Play a role in the function of the restriction enzyme
e. All of the above are correct
All of the above are correct
The denaturation of DNA is
a. Promoted by the heat, low salt concentration, and extremes of pH
b. Reversible
c. Monitored by measuring the absorbance at 300nm
d. Both A and B are correct
e. All of the above are correct
Both A and B are correct
The chain terminating method for sequencing DNA was developed by
a. Maxam and Gilbert
b. Frederick Sanger
c. Watson and Crick
d. Hershey and Chase
e. None of the above are correct
Fredrick Sanger
In a transversion mutation
a. A purine base is substituted for a pyrimidine base
b. A pyrimidine base is substituted for a purine base
c. A purine or pyrimidine base is framsehifted
d. Both A and B are correct
e. All of the above are correct
Both A and B are correct
A nucleoid is:
a. Supercoiled DNA attached to a protein core
b. Negatively supercoiled DNA
c. Positively supercoiled DNA
d. Relaxed DNA
e. Either B or C depending on the organism
Supercoiled DNA attached to a protein core
Chromatin is:
a. Supercoiled DNA
b. DNA complexed with histones
c. Linear uncoiled DNA
d. Relaxed DNA
e. Genes
DNA complexed with histones
Intergenic sequences are
a. DNA segments that do not code for gene product
b. Junk DNA
c. DNA that codes for more than one product
d. DNA which stabilizes the nucleosome
e. Both A and B are correct
Both A and B are correct
Restriction enzymes
a. Prevent DNA synthesis
b. Prevent RNA synthesis
c. Prevent protein synthesis
d. Cut DNA at specific base sequences
e. Both A and B are correct
Cut DNA at specific base sequences
The hypochromic effect is
a. The aggregation of chromatin into large clusters
b. The shift of light absorption to longer wavelengths
c. The formation of chromatin-histone complexes
d. The conversion of B-DNA to Z-DNA
e. The shift of light to shorter wavelengths
The shift of light absorption to longer wavelengths
Which of the following is the largest and most complex structure?
a. Genes
b. Nucleotides
c. Nucleosomes
d. Chromosomes
e. Chromatin
Chromosomes
Which of the following is not a function of RNA?
a. Regulation of gene expression
b. Cell differentiation
c. Catalysis
d. Both A and C are functions of RNA
e. All of the above are functions of RNA
All of the above are functions of RNA
Lysogeny is:
a. Cleavage of the cellular RNA
b. Infection of the host cell by a virus
c. Integration of the virus genome into the host chromosome
d. Formation of the prophage from the viral coat
e. None of the above are correct
Integration of the virus genome into the host chromosome
A defect in which of the following HAR's can result in microcephaly?
a. ASPM
b. FOXP2
c. AMY 1
d. LCT
e. HAR1
HAR1
A mutation caused by an alkylating agent is referred to as
a. Transversion mutation
b. Silent mutation
c. Missing mutation
d. Point mutation
e. Nonsense mutation
Transversion mutation
Which of the following is not an endogenous cause of DNA damage?
a. Tautomeric shift
b. Radiation
c. Deamination
d. Depuration
e. ROS induced oxidation
Radiation
SAM is a methyl donor in the synthesis of
All of the above are correct
A simple system for information flow is composed of
three components : reception, transduction and
response. In multicellular organisms hormones play a role
in which phase?
Reception
Which of the following is an siRNA for eukaryotes?
a) ACUGAAUTCGGCTAAUUTCGGCUAT
b) ACUUAAUGCGCGCUAAUCGCCCGGG
c) ACUUAAUGCUAUAUAGACUAGCCUAGUCCGGCGAAUUAAACCGGGCACCUUU
d) ATCCGCGCTTATCGATCCGATTTAGCCGATTTA
a) ACUGAAUTCGGCTAAUUTCGGCUAT
Has Uracil and Thymine
Which of the following can sequence RNA fragments?
Northern Blotting
Which of the following is a synonymous codon with UCU?
A) AAU
B) UCA
C) GAU
D) AAA
B) UCA
Protein synthesis requires _____ high energy phosphate
bonds per peptide bond.
4
_______ are a group of molecules that mediate protein
folding.
A) Hsp 70s
B) Chaparonins
C) Docking protein
D) Both A and B are correct
E) All of the above are correct
D) Both A and B are correct
Eukaryotic mRNA stability involves
A) Reversible adenylation
B) The length of poly (A) tails
C) The binding of specific proteins to certain mRNA
sequences
D) The action of various nucleases
E) All of the above are correct
E) All of the above are correct
21. ________ provides the energy needed to move the ribosome
along the mRNA.
A) ATP
B) GTP
C) UTP
D) TTP
E) All of the above are correct
B) GTP
In eukaryotic translation the 40S complex binds the 60S
subunit to form the _______ initiation complex.
80S
The Shine-Dalgarno sequence is a
Prokaryotic mRNA sequence that binds 16S rRNA
of the small ribosomal subunit
__________ corrects replication proofreading errors.
Mismatch Repair
Topoisomerases
A) Join DNA strands together
B) Prevent tangling of DNA strands
C) Relieve torque in replicating DNA
D) Change the supercoiling of DNA
E) All of the above are correct
E) All of the above are correct
In the absence of its inducer the lac operon remains
repressed because of the binding of lac repressor to the _______.
Operator
Place the following steps of general recombination in
chronological order
i. DNA ligase seals the cut ends
ii A second series of DNA strand cuts occurs opposite the first crossover strands
iii Two homologus DNA molecules become paired
iv DNA polymerase fills any gaps and DNA ligase seals the cut strands
v Two of the DNA strands are cleaved
vi The two strand segments cross over
iii, v, vi, i, ii, iv
Many promoters for RNA polymerase II contain a consensus
sequence call the _______.
TATA box
DNA transposition can cause gene ______.
A) Duplication
B) Deletion
C) Transcription
D) Both A and B are correct
E) All of the above are correct
D) Both A and B are correct
DNA synthesis is called
Replication