Molecular Biology & Genetics – ASCP Practice Topics

A comprehensive set of question-and-answer flashcards covering key molecular biology, genetics, and clinical molecular diagnostics concepts drawn from the ASCP practice exam material.

Which component is NOT part of a nucleotide?

Anti-codon

According to Chargaff’s rule, adenine pairs with _.

Thymine

Name three genes routinely screened in a breast-cancer NGS panel.

HER2 (ERBB2), ERBB2, BRCA1

Next-Generation Sequencing (Illumina, Ion Torrent) primarily uses _ reads.

Short sequence

Structural difference between purines and pyrimidines?

Purines have two rings; pyrimidines have one ring.

Which two bases are purines?

Adenine and guanine

Typical mutation rate per round of mammalian DNA replication is 1 in _ base pairs.

1,000,000,000 (10⁹)

During agarose electrophoresis, DNA mobility is NOT affected by the molecule’s _.

Nucleotide sequence

Phases seen in a qPCR amplification plot:

Baseline, exponential, plateau

What palindromic sequence is recognized by PstI in the site 5′-CTGCAG-3′?

CTGCAG (it reads the same 5′-3′ on both strands).

Number of CAG repeats in Huntington disease that indicates an affected allele:

≈85 CAG repeats

Two HPV types responsible for most cervical cancers:

HPV-16 and HPV-18

Enzyme that unwinds DNA at the replication fork:

Helicase

Gene mutated in Fragile X syndrome:

FMR1

Characteristic t(11;14) translocation is diagnostic for _.

Mantle cell lymphoma

DNA polymerase with primase activity that initiates replication:

DNA polymerase α

Short discontinuous DNA pieces synthesized on the lagging strand are called _.

Okazaki fragments

After imatinib (Gleevec) therapy, what fusion transcript is monitored?

BCR/ABL

Approximate rate of mammalian DNA replication:

50 nucleotides / second

DNA polymerase that replicates mitochondrial DNA:

DNA polymerase γ

Best routine method to size CAG repeats in the Huntingtin gene:

Standard PCR followed by fragment analysis

Optimal long-term (>7 yr) storage temperature for purified DNA:

−70 °C

On an RFLP gel, a heterozygote with a lost restriction site shows fragments of _ bp.

350 bp, 250 bp, and 100 bp

Lowering stringency during hybridization washes can be accomplished by _.

Increasing salt concentration in the wash buffer

Essential enzyme for Ligase Chain Reaction (LCR):

DNA ligase

NGS workflows require two major steps: _ and extensive bioinformatics.

Library preparation

Subunit of bacterial RNA polymerase that recognizes promoters:

Sigma (σ) subunit

Actual nucleotide change in the Factor V Leiden mutation:

1691G → A (Arg506Gln)

Calculated Tm for the probe CTACCGTAATATTCGACCGT is approximately _.

58 °C

RNA polymerase that synthesizes rRNA in eukaryotes:

RNA polymerase I

Sickle-cell disease illustrates _: one gene influences multiple traits.

Pleiotropy

Which amplification method uses a three-enzyme system and amplifies RNA targets at 41 °C?

NASBA

In qPCR, quantitative measurements are taken during the _ phase.

Exponential (log-linear)

Which tumour listed is NOT a liquid (hematologic) tumor?

Ewing sarcoma

1 OD260 unit of dsDNA corresponds to _ µg/mL.

50 µg/mL

In the wobble position, a uracil at 5′ of the anticodon can pair with _.

A or G

Eukaryotic RNA polymerase responsible for mRNA synthesis:

RNA polymerase II

Assay that amplifies probe signal via Qβ replicase:

Qβ replicase assay

Restriction enzyme class that cuts and methylates adenine in the same reaction:

Type III restriction enzymes

Modification that increases eukaryotic mRNA half-life:

5′ methyl cap

Probability that an affected parent (autosomal dominant) passes the allele to offspring:

50 %

Central dogma of molecular biology describes information flow as:

DNA → RNA → Protein

Drug NOT primarily metabolized by CYP2D6:

Warfarin

Insertion of one base causing downstream frameshift is classified as a _ mutation.

Frame-shift

An autosomal-recessive affected individual transmits the mutant allele with _ chance.

100 % (they carry two mutant alleles)

Replicative DNA polymerase in bacteria that cannot start a strand de novo:

DNA polymerase III

Successful HIV therapy is often defined as ≥0.5 log10 reduction in viral load—true or false?

True (≥0.5 log₁₀ drop)

Which structural arm is NOT found in tRNA?

β (beta) arm

Philadelphia chromosome translocation producing BCR-ABL fusion:

t(9;22)

Common fluorescent dye that binds the minor groove of dsDNA:

SYBR Green I

In molecular cloning, a vector is best defined as _.

A carrier molecule (plasmid, virus) that delivers DNA into cells

5′ RNA cap connects the GTP and nascent RNA via the _ phosphates.

Alpha-beta linkage

Primer dimers generally arise from _ complementarity between primers.

3′-to-3′

The 3′ hydroxyl group in deoxyribose is located on carbon _.

C3′

Hybridization efficiency is influenced by base composition, pH, and temperature – yes or no?

Yes (all of the above)

UGT1A1 polymorphisms alter metabolism of which chemotherapy drug?

Irinotecan

Genes commonly tested in hereditary prostate cancer panels:

HOXB13, BRCA1, BRCA2

RT-PCR statement that is FALSE:

RT-PCR uses alkaline phosphatase to reverse amplify the signal.

Southern blot is NOT used for _.

Chromosomal staining

Among HPV-positive women, _ greatly increases cervical-cancer risk.

Smoking

Which of the following is NOT a common hydrogen-bond acceptor in nucleic acids?

Primary amine

T-cell receptor gene rearrangement is characteristic of which malignancy group?

Non-Hodgkin lymphoma / Sézary syndrome

The t(11;22) translocation creates the EWS-FLI1 fusion seen in _.

Ewing sarcoma

Multiplex PCR is ideal for simultaneously detecting rhinovirus, coronavirus and influenza – why?

It amplifies multiple targets in one reaction using several primer pairs.

Bench decontamination after PCR is best achieved with _.

5 % bleach (sodium hypochlorite)

Which molecule is NOT a component of nucleic acids?

Formamide

Amelogenin PCR giving 212 bp and 218 bp peaks indicates the sample is from a _.

Male (both X and Y alleles present)

Technique that amplifies target using DNA polymerase and thermal cycling:

PCR

During chain elongation, the 3′-OH attacks the _ phosphate of the incoming dNTP.

Alpha phosphate

Gene monitored to optimize warfarin dosing:

VKORC1

Protein synthesis from mRNA is called _.

Translation

Estimated number of SNPs (polymorphisms) in the human genome:

≈10 million

Most polymorphic region used for transplant compatibility testing:

HLA locus

Sense strand corresponding to 5′-AATTGCCGACATAGAT-3′ (anti-sense) is _.

5′-ATCTATGTCGGCAATT-3′

CFTR gene mutations cause _.

Cystic fibrosis

Karyotype 47,XY,+21 diagnoses _.

Down syndrome (Trisomy 21)

In real-time PCR, what gets amplified?

The target nucleic acid

HLA-DR typing by SSO/NGS focuses on exon 2 of the _ subunit.

β (beta)

Average rate of eukaryotic mRNA translation:

≈60 nucleotides / second

Molecular beacons generate fluorescence during the _ step of PCR.

Annealing (probe-binding) step

Most common HFE mutation causing hereditary hemochromatosis:

C282Y

Duchenne muscular dystrophy is due to defects in the _ gene.

Dystrophin

Consensus polyadenylation signal recognized by poly(A) polymerase:

AAUAAA

Splicing removes and joins .

Removes introns; joins exons

In melt-curve analysis, fluorescence sharply decreases at the _.

Melting temperature when probe or dsDNA strands separate

Melting temperature of a PCR product depends on sequence length and GC content – true or false?

True

All PCR products generated by the same primer pair should share the same Tm – yes or no?

Yes (unless non-specific products are present)

Acute promyelocytic leukemia is associated with which translocation?

t(15;17)

Genes typically screened in a colorectal‐cancer panel:

KRAS, BRAF, PIK3CA

Hepatitis C genotypes that respond poorly to interferon/ribavirin therapy:

Genotypes 1 and 4

Offspring of two heterozygous carriers for an autosomal recessive disease show what genotype ratio?

25 % homozygous normal, 50 % carriers, 25 % homozygous affected

RNA polymerase responsible for tRNA synthesis:

RNA polymerase III

Signal-amplification assay that employs alkaline phosphatase–labeled probes:

Branched DNA (bDNA) assay

Genes often tested in a lung-cancer panel:

KRAS, EGFR, ALK

Best molecular method to size unstable trinucleotide repeats (e.g., Huntington’s):

VNTR/Fragment length analysis

Factor V Leiden detection is commonly performed with _.

PCR-RFLP

Which step is NOT part of a Southern blot?

Probe digestion

Before bone-marrow transplantation, finding at least one informative polymorphic locus between donor and recipient helps monitor _.

Engraftment and chimerism