Bio Grade 12: Chapter 5

What is the main role of the DNA molecule?

It codes for the order and type of amino acids that make up proteins (a polymer), which are important for practically every process that takes place in cells.

What is the main role of RNA

help in protein synthesis

to direct the production of proteins.

where is an organism's genome is located

in the nucleus

What does DNA code for?

the order and type of amino acids that make up proteins (a polymer), which are important for practically every process that takes place in cells.

Where are proteins synthesized?

cytoplasm by ribosomes

Why is mRNA necessary?

Since DNA is in the nucleus mRNA helps ribosome (which is in the cytoplasm) get access to the unique coding

What is the difference between transcription and translation?

-Transcription is the process where the information found in DNA is copied in the form of a single-stranded nucleic acid called mRNA (making single-stranded copies is more energy efficient).

-Translation involves ribosomes using the mRNA as a blueprint to make protein (so it can put the appropriate types of amino acids in a certain order).

How is DNA different from RNA

-RNA is single-stranded while DNA is double-stranded

-RNA contains Uracil (U) instead of Thymine which is found in DNA. Both Uracil and Thymine bind with Adenine.

-RNA's ribose sugar is different because it also has a hydroxyl group on its 2' carbon. DNA has only a hydrogen on its 2' carbon which is why DNA is called "DEOXYribonucleic acid"

what are the 3 main classes of the RNA molecule

1. messenger RNA (mRNA)

2. transfer RNA (tRNA)

3. ribosomal RNA (rRNA)

What is the role of mRNA?

supply the ribosomes with the coding necessary for protein production.

it varies in length because it doesn't make copies from the entire DNA molecule, but instead only codes for smaller sections which code for particular genes.

what is the role of tRNA

to transfer the appropriate amino acid to the ribosome to build the protein, as directed by the mRNA template.

what is the role of rRNA

to give ribosomes their structure (along with protein).

What are the enzymes involved in post transcriptional modifications?

Poly-A polymerase and spliceosomes.

what are the 3 phases of transcription

1. Initiation

2. Elongation

3. Termination

What happens in initiation? transcription

-Where transcription starts

-RNA polymerase binds to the promoter (the upstream area of DNA) and indicates to RNA where to start

-This region is found on one strand of DNA that is particularly high in adenine and thymine bases. This serves as the recognition site for the beginning of this gene

-this is because A and T are being bonded together by 2 hydrogen bonds while G and C are bonded together by 3. this makes A and T bonds easier to break/unzip because it takes less energy to break.

What happens in elongation? transcription

Here the mRNA is built in the 5' to 3' direction, without the need for a primer. The promotor sequence doesn't get transcribed.

The DNA strand that is used to code for the mRNA is called the template strand.

The other strand that isn't used for transcription is the coding strand.

What is the template strand? What is the coding strand?

template strand: The original strand that is being used to copy and make complementary pairs.

coding strand: The DNA strand that is not copied to synthesize a molecule of RNA

Strand of DNA that is complementary to the template strand

how is the mRNA sequence is identical to the coding strand

Since the coding strand of the DNA has bases complementary to the template strand, the mRNA has the same sequence of bases at the upper strand (coding strand) of DNA (with U substituted for T)

what is termination? transcription

At the end of a gene, there is a terminator sequence which tells the RNA polymerase to stop.

-When this sequence is reached, the mRNA comes off the template strand.

-RNA polymerase is then free to transcribe another gene.

Why is a G-C pair harder to separate compared to A-T?

An A-T pair is easier to break ("unzip") because it only contains two hydrogen bonds, compared to a G-C pair (which has three). It takes less energy this way.

What is the difference between a coding strand and a template strand?

The coding strand determines the correct nucleotide sequence of mRNA. The template strand acts as a base for the mRNA transcription.

posttranscriptional modification

The process in eukaryotic cells where the (primary transcript) needs to be modified before it exits the nucleus. It adds a 5' cap to the beginning of mRNA and a 3' end also known as the poly-A tail

Why is the 5' cap needed at the start of mRNA in eukaryotes

It protects the mRNA from digestion as it exits the nucleus and enters the cytoplasm of the cell.

It also helps initiate translation.

What does poly-A polymerase do?

an enzyme that adds a string of about 200 adenine base pairs to the 3' end of the primary transcript

-This forms a "poly-A tail".

-This whole process is called capping and tailing.

what are exons and introns? How do splicsome play a role in this? Overall how is this used in posttranscriptional modification

exons: coding regions

introns: non coding regions

In eukaryotic cells, the genes in DNA have coding (exons) and non-coding (introns) regions.

-Spliceosomes cut out the intron regions so that only the exon regions are present in mRNA that gets sent to the ribosome.

Therefore, this mRNA transcript contains continuous coding regions that can now form the proper protein once it's sent to the ribosome.

How is translation initiated?

a protein is manufactured once a ribosome binds to an mRNA molecule, recognizing the 5' cap. This initiates the translation of nucleic acid into protein.

in eulkaryotes, what are the 2 subunits of ribosome and what happens when they come together

The large is subunit is 60S and the small subunit is 40S

When they come together, they make an 80S ribosome (they fit close to each other), and mRNA is clamped down between these two subunits.

What is a reading frame? What does each triplet code for? (translation)

the order in which nucleotides are read. The mRNA is read in triplets of nucleotides (sets of three)

codes for a specific amino acid

why is it important that mRNA is positioned correctly

if the ribosome starts reading on a different base pair (perhaps shifted over by one base), the reading frame can change. Therefore it's important that the mRNA is positioned correctly so it lines up with the correct reading frame for the intended protein.

What is a codon? Anticodon?

A codon is ​a sequence of three nucleotides that together form a unit of genetic code in a DNA or RNA molecule. Such as UAG, AGA, GAC. (each triplet of nucleotides)

An anticodon is a series of 3 unpaired bases that is complementary to to a codon. For example the codon UAC‛s anticodon is AUG.

Why are 3 bases needed to code for 20 amino acids?

to allow for enough combinations to represent the 20 amino acids

why are there multiple codes for one amino acid

This redundancy minimizes errors that might lead to harmful mutations.

what is the difference between a start and stop codon (translation)

one codon serves as a start codon (Aug), and codes for Met

three codons function as a stop codon. Once the ribosome encounters one of these, protein synthesis stops

What is the role of tRNA in translation? Explain its structure

Transfer RNA (tRNA) delivers the amino acids to the polypeptide (protein) building site.

-It kind of looks like a cloverleaf. At one arm of the tRNA is a sequence of three bases (the anticodon) that corresponds to the codon on the mRNA (ex, if the mRNA has the codon ACC, then the complimentary base sequence on the anticodon arm is UGG)

- There is a different tRNA molecule for each anticodon combination, and each of these tRNA molecules has the appropriate amino acid attached to it on the other end, used by the ribosome to make protein.

List the possible anticodons for the amino acid threonine (Thr) - you need to look at your chart.

Thr: ACU, ACC, ACA, ACG

Anticodons: UGA, UGG, UGU, UGC

What is aminoacyl-tRNA?

when a tRNA is linked to its amino acid

how does the polypetide chain in translation first start

The ribosome first recognizes the start codon (AUG) which codes for methionine and it sets the correct reading frame.

What are the sites in the ribosome for tRNA binding (translation)

A: Acceptor site

P: Peptide site

E: Exit site

How does the polypeptide chain grow?

-The tRNA first takes the methionine to the P site. The next tRNA carrying the appropriate amino acid then enters the A (acceptor) site.

-Then the two amino acids in the ribosome attach together at the P site (the P site holds the tRNA attached to the growing peptide) forming a peptide bond. This starts things off.

-Now the ribosome then shifts over (translocates) one codon at a time by feeding the mRNA through. Everything from the A (acceptor) site gets shifted to the P site (where the peptide grows).

-The P site tRNA now moves to the exit site, where it leaves "empty" (no amino acid attached).

Now the A site is open to receive another tRNA. The tRNA molecules that have been released can then pick up more of the appropriate amino acids.

what happens during termination (translation)

happens when the ribosome encounters a stop codon (don't code for any protein so now tRNA comes in)

-A protein called the release factor is activated once the ribosome stalls on a stop codon, and it separates the two rRNA subunits and translation stops.

Proteins at this point might be modified in a number of way

Explain why the process of translation has been appropriately named.

The definition of translation is the process of translating words or text from one language to another. The process through which information encoded in messenger RNA (mRNA) directs the addition of amino acids during protein synthesis.

Explain why an error in the third base of a triplet may not necessarily result in a mutation.

An error in the third base of a codon in mRNA may not necessarily result in an error during the process of translation because more than one codon encodes a particular amino acid. If the third base in a triplet is substituted for another base, the resulting triplet may still code for the same amino acid.

All of our cells contain the same DNA. How is it possible to get different kinds of body tissue

(that is, cells can look different despite having the same DNA).

These cells are different because they use the same set of genes differently. So even though each of our cells has the same 20,000 genes, each cell can select which ones it wants to "turn on" and which ones it wants to keep "turned off".

What is meant by the term "housekeeping genes"?

Genes that must be on all the time and must be transcribed and translated constantly.

What are transcription factors?

they turn on genes when they are required

What are the four levels of gene regulation in eukaryotic cells?

Transcriptional: regulates which genes are transcribed or controls the rate at which they are transcribed.

Post-transcriptional: mRNA undergoes changes in the nucleus before translation occurs, and involves removing introns and splicing together exons.

Translational: controls the length of time translation can take, and the time it takes for "used" mRNA to be broken down in the cytoplasm.

Post-translational: the rate is controlled regarding how long it takes for a protein to become active and how long it can remain functioning, as well as adding various chemical groups to it.

What is the difference between an operon and an operator?

An operon is a cluster of genes under control by an operator

lac operon

a gene system whose operator gene and three structural genes control lactose metabolism in bacteria

various bacteria get their energy from lactose but before they can use this energy it needs to be spilt into glucose and galactose by the enzyme β-galactosidase. If there was no lactose nearby then there is no reason for this enzyme.

-The gene for β-galactosidase is part of an operon called a "lac operon" which consists of three genes to be translated: lacZ, lacY, and lacA (they all code for proteins that are involved in the process of breaking this sugar down).

Explain why the lac operon is an example of negative regulation.

In order for bacteria to use the energy from lactose it must first be spilt into glucose and galactose by the enzyme β-galactosidase. If there was no lactose nearby to be spilt then there would be no need for the enzyme.

-Using negative regulation the production of β-galactosidase is blocked if lactose is not present. Bacteria cells only produce this enzyme when necessary - by controlling the gene's transcription and translation.

what happens when lactose levels are low

When lactose sugar levels are low, the regular form of the LacI protein can be found. It's called a repressor protein because it has the ability to block transcription from happening, and when it's doing this, it's called the "active repressor".

LacI easily binds to the operator, and because the promotor and operator regions overlap, it also blocks the promotor at the same time. The promotor region is the site where RNA polymerase must start, but it can't.

what happens when lactose levels are high

When lactose levels increase it as an inducer by binding to the Lacl protein. Increasing amounts of lactose naturally bind to the Lacl protein.

This binding changes the shape of the LacI protein and it no longer can bind to the DNA to block the RNA polymerase (it "falls off"). It's now becomes the "inactive repressor".

The RNA polymerase can now make the gene products.

Therefore, lactose itself can thus control the activity ofthe genes that digests this sugar.

trp operon

-Tryptophan is an amino acid used by bacteria to make protein.

-Once tryptophan gets too

high, the genes for tryptophan production are no longer transcribed.

-This operon is made of 5 genes that code for proteins (enzymes) that help make tryptophan.

Explain why the lac operon differs in functioning (and regulation) compared to the trp operon.

In the trp operon, once tryptophan gets too high, the genes from tryptophan production are no longer transcribed and shut the operon off. In the lac operon, the opposite happens. When lactose levels are high the operon turns on.

what happens when tryptophan is low?

The operon is free to translate these genes, because tryptophan is needed.

There is a repressor protein that can bind to the operon to block it, but it's in its inactive form (the "inactive repressor") so it can't bind.

what happens when tryptophan is too high?

Once this amino acid level starts to rise, it starts to bind increasingly to this trp repressor protein, changing its shape(making it an "active repressor"), and allowing it to bind to the trp operator to block it (blocking RNA polymerase). Since tryptophan itself is needed to inactivate the trp operon, it's called a corepressor.

Summary of lac and trp operon

The LacI repressor protein binds to the operator when lactose levels are low. High levels of lactose INDUCE the operon.

The trp repressor protein binds to the operator when tryptophan levels are high. High levels of tryptophan Repress the operon.

Suppose a mutation is found in the gene for the LacI protein. What do you think will happen to the lac operon (specifically)?

If there was a mutation in the operator the repressor protein will not bind to the operator if there is no lactose in the environment. Due to this, the transcription will not be stopped and there will be continuous transcription.

Why do you think that promotor regions are usually high in adenine and thymine?

Since adenine and thymine only share two hydrogen bonds between them, RNA polymerase will use less energy in opening up the double helix at this point.

what happens during transcription

-Transcription takes place in the nucleus.

-The weak hydrogen bonds break and a section of DNA is unwound and the two strands separate.

-One strand is used as a template.

-Complementary bases to this strand link to it.

-mRNA is formed.

-mRNA stands for messenger RNA

-mRNA moves out of the nucleus into the cells cytoplasm

what happens during translation

-Translation takes place in the cytoplasm when the mRNA attaches to a ribosome.

-The ribosome moves along the mRNA in one direction reading a triplet of bases (codon) at a time.

-tRNA molecules bring amino acids to thee ribosome. The amino acids attached to each tRNA molecule depends on the order of bases in the tRNA.

-Complementary bases of tRNA pair with the bases of the mRNA strand.

-Amino acids that are close together are joined to make an amino acid chain (a polypeptide)

-Every protein is formed from a specific number of amino acids in a particular order. The order of the bases in the DNA defines the order in which the amino acids are joined together. So one section of DNA codes for one particular protein.

What is a mutation?

they are mistakes made in the DNA that are inherited. Mutations can be harmful, beneficial, or neutral.

Change in DNA sequence

what are the different types of mutation and explain them

Frameshift mutation: The addition or loss of DNA (an insertion or deletion mutation) results in a change in the reading frame for the gene

If the ribosome can't line up with the proper base to start (it reads in groups of three), having the starting base even off by one means that the whole protein will be read incorrectly.

Point mutation: Mutations at a specific base pair along a nucleotide sequence, not changing the reading frame of the gene to be read by the ribosome.

Nonsense mutation: Occurs when a change in the DNA sequence causes a stop codon to occur too early (the mutation looks like a "STOP")

Missense mutation: These happen when a codon is altered but this time resulting in a different amino acid being included in the protein sequence

Silent Mutation: they have no effect on the cell's operation and usually occur in the non-coding regions (introns) of DNA, and are very common. They may be cut out when mRNA is prepared to be sent out to the cytoplasm for translation.

Explain why if there is a defective gene passed down from one of our parents, it might not be

harmful to us (2 reasons).

We are diploid organisms which means we have two copies of each gene and are better off because if one gene is defective, the other gene may compensate. Some positive mutations can result in complex structures. An example is an eye and the brain.

Which two types of mutations, nonsense or missense, would be more harmful to an organism?

Justify your answer using your knowledge of protein synthesis.

Nonsense mutations would be more harmful because missense mutations result in a different amino acid included in the protein sequence while nonsense mutation causes a stop codon to occur too early. This means that a large part of the protein would not be made.

What kinds of mutations can happen with overall chromosome structure (large DNA segments)?

1. Deletion: chromosome fragment fails to reattach to the homolog and is somehow lost.

2. Duplication: if this separated fragment reattaches to a complete homolog.

3. Inversion: if this segment reattaches to the correct homolog but in reverse order.

4. Translocation: a segment of DNA attaches to a nonhomologous chromosome (a different chromosome, not part of the "pair").

what mutations are point mutations

silent, missense and nonsense

what are the different cause of mutations

Some are caused by an error in the genetic machinery and these are called spontaneous

mutations

when the DNA is checked for errors after duplication (resulting in point mutation)

Mutations can also be caused by exposure to mutagenic agents, so, therefore, they can be considered to be induced mutations

What are oncogenes? Why are they potentially dangerous?

They are damaged copies of genes that control normal cell growth and division. They are dangerous because they can lead.

Name three factors that can produce gene mutations.

Radiation (ex, UV and X-Rays), Chemicals (Cigarettes, BBQ) and Infectious agents (HPV).

what is the difference between prokaryotes and eukaryotes (protein synthesis)

Prokaryotes: Transcription and Translation occur simultaneously

Eukaryotes: Transcription occurs in the nucleus while translation occurs in the cytoplasm

Prokaryotes: They do not have non-coding regions (introns)

Eukaryotes: They have coding and non-coding regions (exons and introns

Prokaryotes: The ribosome recognizes the start of a piece of mRNA from a sequence called the Shine-Dalgarno sequence

Eukaryotes: The ribosome recognizes the 5' cap as the start of a piece of mRNA

Prokaryotes: Prokaryotes have smaller ribosomes

Eukaryotes: Eukaryotes have bigger ribosomes

Prokaryotes: Have operons

Eukaryotes: Do not have operons

Prokaryotes: Circular DNA

Eukaryotes: Chromosomes

How is DNA able to fit into our bodies?

DNA is tightly packed

This is because of supercoiling. First what happens is around 200 nucleotides are coiled around an 8-member protein called a histone. The nucleotides and histones make up a small unit called a nucleosome. Second, these nucleosomes coil up to turn into chromatin fibres. Third, these fibres fold again to make up the overall chromatin structure and this form of coiling is called supercoiling.

What are VNTRS and what do they do?

VNTRs are sequences (In DNA) that consist of base pairs that repeat over and over again (ex, GATAGATAGATAGATAGATA). They can act to protect the DNA. It protects the end of its chromosomes from being degraded using telomeres, which are non-coding regions of repetitive DNA bound with protein.

What is the significance of properly functioning telomeres?

Along with VNTRs, they protect the end of its chromosomes from being degraded.

What is the difference between a centromere and a telomere?

A centromere is a place where two chromosomes are being held together at once they are copied. A telomere is at the end of the chromosome and is a non-coding region of repetitive DNA bound with protein.

What would happen if a SINE were found in an extron, an intron and, a telomeric region

a) an exon: They could cause improper slicing of this coding region

b) an intron: Intron would not be sliced

c) a telomeric region: removes the telomeres which can cause degradation of a chromosome.

what are pseudogenes and why do they exist?

similar to ordinary genes but they aren't made into mRNAand protein

can be used to determine the rate of gene duplication and follow the evolution of sequence changes in organisms

what are LINES and SINES

LINEs: long interspersed nuclear elements.

SINEs: short interspersed nuclear elements.

Two types of "defective" copies of functional genes