BIOL 221 Exam 4 MCQs

It was mentioned in an earlier lecture that science should be “predictive”.  What does this mean? A.    If you repeat the same experiment, you will get the same results. B.    You know in advance which experiments will work and which will not. C.    If you change a variable in an experiment, you know how the results will change. D.    You can try a completely new experiment and know in advance what the results will be. E.    You can deduce how a biological system will evolve in the future.

if you can change a variable in experiment, you will know how the results change

The hydrophobic effect is used to explain \______________________. A.    why H2O has a heat capacity B.    the mechanism of dehydration synthesis reactions C.    the ability of nonpolar molecules to form van der Waals bonds D.    how micelles form in an aqueous environment E.    the concept of pH

how micelles form in an aqueous environment

A phosphodiester bond is important in the structure of \___________. A.    phospholipids B.    an alpha helix C.    RNA D.    phosphorylated proteins E.    the PTS system

RNA

What type of microscope views a specimen with light reflected (refracted) from the specimen rather than passed through the specimen? A.    dark field B.    differential interference contrast (Nomarski) C.    confocal scanning laser D.    phase contrast E. bright field

dark field

Last semester when he was working with bacteriophage in the lab, a student came to me and said his doctor had diagnosed him with a viral infection. The student was pretty sure he had acquired the infection from the bacteriophage he was working with in the lab. What would you have told the student? A.    The student should work on his sterile technique so something like this does not happen again. B.    Bacteriophage do not have DNA so the infection should not be too serious. C.    Bacteriophages are dimorphic. We do not use the human variety in the lab. D.    Bacteriophages cannot infect humans. E.    Bacteriophages are not viruses.

bacteriophages cannot infect humans

The purpose of osmoprotectants accumulating within bacterial cells is to \__________________. A.    prevent the cytoplasm from shriveling up in hypoosmotic environments B.    prevent the cytoplasm from shriveling up in hyperosmotic environments C.    prevent the cell from lysing in hypoosmotic environments D.    prevent the cell from lysing in hyperosmotic environments E.    prevent the cell from either lysing or shriveling up depending on the environment

prevent the cytoplasm from shriveling up in hyperosmotic environments

Which of the following microscopes depends on the phenomenon of photon drag to differentiate between structures with a different refractive index (density)? A.    dark field B.    differential interference contrast (Nomarski) C.    confocal scanning laser D.    phase contrast E.    bright field

phase contrast

Which of the following is a hallmark (specific feature) of protozoa but NOT of bacteria? A.    Two cell forms – yeast and mold B.    The presence of a cytoskeleton C.    A saprophytic lifestyle D.    Endocytosis to engulf nutrients E.    Live in an extreme environment

endocytosis to engulf nutrients

A positive diagnosis for a particular disease is made by examining a throat swab stained with the acid-fast stain. What organism is causing this disease? A.    An enveloped virus like influenza B.    Mycoplasma C.    Mycobacterium D.    An encapsulated organism like Klebsiella E.    A Gram-positive organism like Streptococcus

mycobacterium

In order to make ATP, a bacterium needs a ΔpH of approximately 2. Assume ions can pass through porins freely. If the bacterium is growing in a neutral solution, what must be the proton concentration in the bacterial cytoplasm? A.    2 molar B.    10^-2 molar C.    10^-9 molar D.    10^9 molar E.    10^2 molar

10^-9 molar

Which of the following reactions involves a net release of free energy? A.    Adding phosphate to the structure of a protein B.    Reducing CO2 to glucose C.    Making a membrane from phospholipids D.    Assembling a protein from amino acids E.    Making glucose from starch

making glucose from starch

Mycolic acids cause mycobacteria to \_________________. A.    be toxic to humans B.    stick to surfaces C.    resist chemical damage and dehydration D.    be Gram positive E.    be shapeless

resist chemical damage and dehydration

Two molecules are composed of the same atoms, but the molecules have different molecular weights. This can be explained by the existence of \_____________. A.    a dipole moment B.    sp3 orbital hybridization C.    ions D.    isotopes E.    isomers

isotopes

The picture at the right shows an unusual type of bacterium that has its flagella within its periplasm. What microscopic technique was needed to observe these flagella? A.    Phase contrast microscopy B.    Scanning electron microscopy C.    Electron chromatography D.    Electron cryotomography E.    Atomic force microscopy

electron cryotomography

What is currently our best description of a biological membrane? A.    The outside part of the membrane is phosphate, while the inside part is lipid. B.    The inside part of the membrane is phospholipid, while the outside part is protein. C.    About 50% protein with phospholipids grouped into mobile rafts between the proteins. D.    Mostly phospholipids with a few peripheral and integral membrane proteins. E.    Mostly protein with a few phospholipids scattered among the proteins.

about 50% protein with phospholipids grouped into mobile rafts between the proteins

How is the energy of a H+ gradient most directly used by the cell for the uptake of glucose? A.    The H+ gradient makes ATP which powers a glucose transporter. B.    Binding of a H+ flips the transporter to the alternate conformation. C.    Binding of a H+ holds the transporter open until the glucose also binds. D.    The H+ provides a charge gradient that pulls the glucose into the cell. E.    The H+ binds to the glucose and makes it impossible for glucose to leave the cell.

binding of a H+ holds the transporter open until the glucose also binds

What would happen to Mycoplasma cells placed in a solution that was hypotonic with respect to the cytoplasm of cells? A.    They would not experience any changes. B.    The would experience an increase in turgor pressure but would not lyse. C.    They would lyse. D.    They would synthesize osmoprotectants. E.    They would plasmolyze.

they would lyse

What is the role of the periplasmic binding protein in ABC uptake systems? A.    It blocks reverse transport of the solute. B.    It is a chaperone that keeps secreted proteins folded. C.    It provides energy to “switch” the conformation of the transporter. D.    It provides a channel through the outer membrane. It hydrolyzes ATP

it blocks reverse transport of the solute

Which of these are important for the function of flagella but not for Type III secretory systems? A.    A hollow exterior filament B.    A H+ channel C.    Membrane bushings D.    A rotor complex E.    An ATPase

a H+ channel

What is the “Sec translocon”? A.    A transporter that imports fully folded proteins. B.    A transporter that moves molecules through the outer membrane. C.    A transporter that inserts proteins with a signal sequence through the cytoplasmic membrane. D.    A chaperone that keeps proteins unfolded for insertion through the cytoplasmic membrane. E.    A transporter that makes a single channel through both bacterial membranes.

a transporter that inserts proteins with a single sequence through the cytoplasmic membrane

Structures that transport electrons between bacterial cells in a dense cultures are called \___________. A.    Nanowires B.    Biofilms C.    Glycocalyses D.    Electrosomes E.    Electron transport chains

nanowires

It is important for a bacterium to keep its membranes from either melting or solidifying as the temperature of the environment changes. Membranes of psychrophilic bacteria must, therefore, have more \________ than membranes of mesophiles. A.    phosphate groups B.    lipopolysaccharide C.    saturated lipids D.    trans-unsaturated lipids E.    cis-unsaturated lipids

cis-unsaturated lipids

Addition of yeast extract to a bacteriological growth medium would be most important for the growth of \__________________. A.    Prototrophs B.    Phototrophs C.    Auxotrophs D.    Autotrophs E.    Lithotrophs

auxotrophs

Why is a glycocalyx usually viewed by using the negative staining procedure? A.    This stain is required for the type of microscope usually used to see a glycocalyx. B.    The glycocalyx contains a thin layer of sugars much like thin peptidoglycan. C.    The glycocalyx contains negatively charged phosphate groups. D.    The glycocalyx usually has no charge. E.    The glycocalyx usually has a positive charge.

the glycocalyx usually has no charge

A pharmaceutical technician wished to produce large quantities of a bacterial secondary metabolite from a chemolithotroph. She grew the organism in a chemostat with glucose, H2S (hydrogen sulfide) and oxygen along with trace elements and growth factors. The technician got very low yields of the secondary metabolite. What was the mistake the technician made in this growth experiment? A.    The technician did not wait long enough. B.    The technician needed to add sulfate in addition to H2S. C.    The technician should have used a batch culture to ensure the cells reached stationary phase. D.    The oxygen was probably toxic to the bacteria. E.    The technician should not have used glucose.

the technician should have used a batch culture to ensure the cells reached stationary phase

What do bacterial ABC drug (antibiotic) efflux pumps and Type III secretion systems have in common? A.    Neither requires contact with another cell to initiate transport. B.    Neither involves a periplasmic intermediate. C.    Both allow transport of fully folded proteins. D.    Both are structurally related to flagella. Both make use of a needle complex

neither involves a periplasmic intermediate

Why does E. coli reverse the direction of its flagella rotation periodically? A.    It does not. E. coli flagella fall apart if they reverse rotation. B.    The reversal is random. It is not regulated by the E. coli. C.    So the cell can make ATP rather than use ATP to turn the flagella. D.    The cell fails to encounter a higher attractant concentration. E.    That is how the cell reverses the direction in which it is traveling.

the cell fails to encounter a higher attractant concentration

How should you try to grow a bacterium that cannot make its own ATP? A.    It should be grown on a layer of eukaryotic cells in tissue culture. B.    ATP should be provided in the growth medium for this bacterium. C.    It should be grown in a specialized atmospheric chamber. D.    The bacterium should be grown with complex growth factor supplements. E.    It would not be possible to growth this bacterium in the laboratory.

it should be grown on a layer of eukaryotic cells in tissue culture

Molecule A donates electrons to Molecule B. Which of the following is true? A.    During the reaction, Molecule B loses some energy but not as much as Molecule A gains. B.    During the reaction, Molecule A loses more energy than Molecule B gains. C.    During the reaction, Molecule B loses more energy than Molecule A gains. D.    Molecule B has a higher energy level than Molecule A at the beginning of the reaction. E.    Molecule A is being reduced during this reaction.

during the reaction, Molecule A loses more energy than Molecule B gains

What does it mean to say that a bacterial colony is “clonal”? A.    All the colonies on a Petri dish are of the same type. B.    All the cells in the colony arose by binary fission from a single cell. C.    All the cells in the colony look the same though they may not be genetically identical. D.    All the cells in a colony are genetically engineered with a cloned protein. E.    All the cells in the colony are growing as fast as they can.

all the cells in the colony arose by binary fission from a single cell

What is the purpose of beta oxidation? A.    It is a type of bacterial secondary metabolism. B.    It is a way to make bacterial cell wall precursors. C.    It is a way to turn fatty acids into TCA cycle precursors. D.    It is a way to feed cellulose monomers into the pentose phosphate pathway. E.    It is a way to break down protein secondary structures.

it is a way to turn fatty acids into TCA cycle precursors

Why is a freezer culture of bacteria stored in a solution of glycerol? A.    Glycerol keeps bacteria metabolically inert during long storage. B.    Glycerol is important as an osmoprotectant in these bacteria. C.    Glycerol provides growth factors that are useful when the culture is revived. C.    Glycerol disrupts the hydrogen bonding structure of frozen water. D.    Glycerol provides a carbon source for bacteria.

glycerol disrupts the hydrogen bonding structure of frozen water

Which of the following is true about an allosteric inhibitor? A.    There is no way to predict the shape of such an inhibitor. B.    The inhibitor must at least partially resemble the substrate. C.    The inhibitor must be present in a large excess over the substrate. D.    The inhibitor alters the active site without binding to it. E.    The inhibitor binds to the substrate rather than to the enzyme.

the inhibitor alters the active site without binding to it

The luciferase reaction is not routinely used to obtain an accurate bacterial titer. Why not? A.    It is based on a statistical estimate of growth. B.    You do not see a reaction with fewer than 107 bacteria per mL. C.    The amount of ATP produced per cell is not constant. D.    Dead cells do not produce ATP. E.    Luciferase is not a bacterial enzyme.

the amount of ATP produced per cell is not constant

The main purpose of fermentation reactions in a bacterial cell is \________________________. A.    to make PMF in the absence of an electron transport chain B.    to carry out the first step in anabolic reactions that make new cell material C.    to prepare pyruvate to enter the TCA cycle D.    to generate a little bit more energy than what is produced in glycolysis E.    to oxidize NADH

to oxidize NADH

In the United States, swimming beaches are periodically tested for bacterially counts.  In Indiana, a beach is closed if the bacterial titer exceeds 125 bacteria per 100mL.  Which of the following would be the best way to determine this titer? A.    Petroff-Hauser chamber B.    Weighing a cell pellet C.    Membrane filtration and plating D.    Coulter counter E.    Spread plating on agar petri dishes

membrane filtration and plating

Secondary metabolites, such as antibiotics, are produced most effectively \________________. A.    when nutrients are constantly added to the culture B.    as cells are adapting to growth in new medium C.    when the number of cells \= N0eµt D.    by cells in crowded growth conditions E.    by persister cells

by cell in crowded growth conditions

Which of the following best describes how ATP is produced by oxidative phosphorylation? A.    The PMF turns a rotor which pushes ADP and phosphate together. B.    Electrons from the transport chain reduce ADP to ATP. C.    Electrons from the transport chain turn a rotor to make ATP. D.    The PMF adds a proton to ADP to make ATP. E.    The PMF reduces NADH to ATP.

the PMF turns a rotor which pushes ADP and phosphate together

What characteristic is specific to Agrobacterium? A.    Invasion of the periplasm of other Gram-negative bacteria. B.    Reduction of O2 concentration to allow nitrogenase to function. C.    Release of digestive enzymes in response to quorum sensing. D.    Natural insertion of DNA into plant cells. Cultivation of fungal symbionts.

natural insertion of DNA into plant cells

Deinococcus bacteria can be found uniquely in what environment? A.    Very low nutrient levels B.    Very high radiation levels C.    Very high salt concentrations D.    Very high temperatures E. Very low pH

very high radiation levels

Why is non-cyclic photosynthesis also called “oxygenic” photosynthesis? A.    It is usually an anaerobic process. B.    It uses the same respiratory chain as mitochondria but in reverse. C.    The electron donor for Photosystem II is H2O. D.    O2 is produced during the electron transfer from Photosystem I to Photosystem II. E. The electron acceptor for Photosystem I is O2.

the electron donor for Photosystem II is H2O

How would you treat an implantable cardiac defibrillator before installing it in a patient? A.    Sterilize with ethylene oxide. B.    Sterilize with iodine. C.    Disinfect with a quaternary amine. D.    Wash it with 70% alcohol. E.    Autoclave it.

sterilize with ethylene oxide

A major difference between quinones and hemes in the electron transport chain is that \________. A.    quinones are a terminal electron acceptor while hemes are an initial electron donor B.    quinones have a lower energy level than hemes C.    quinones are produced in the TCA cycle while hemes are produced in glycolysis D.    quinones accept both electrons and H+ while hemes only accept electrons E.    quinones can only be oxidized while hemes can only be reduced

quinones accept both electrons with H+ while hemes only accept electrons

Which of the following are famous for their ability to sense the presence of other bacteria, secrete slime trails, and aggregate together by social gliding motility into large, complex, spore-producing structures called “fruiting bodies”? A.    Myxobacterium B.    Picrophilus C.    Corynebacterium D.    Bdellovibrio E. Caulobacter

Myxobacterium

As applied to a medical setting, which of the following correctly describes a critical instrument? A.    It must be inserted in boiling water before it can be used. B.    It could be used after treatment in an ethylene oxide autoclave (chamber). C.    High-level disinfectants must be used to clean it. D.    It must be rigorously decontaminated with soap and warm water. E.    It includes anything that touches a patient’s bare skin.

it could be used after treatment with an ethylene oxide autoclave (chamber)

What determines whether a region of a bacterial genome will be transcribed into mRNA? A.    All DNA is eventually transcribed. B.    The presence of a promoter. C.    Binding of a part of RNA polymerase to a DNA sequence. D.    Binding of an initiator protein to an RNA sequence. E.    The present of a start codon.

binding of a part of RNA polymerase to a DNA sequence

How does ABE fermentation in Clostridium species differ from lactic acid fermentation performed by many other bacteria? A.    ABE fermentation is aerobic, but most other fermentation is anaerobic. B.    ABE fermentation produces methane. C.    ABE fermentation can produce some additional ATP. D.    ABE fermentation reduces NAD+ rather than oxidizing NADH. E.    ABE fermentation can ferment lipids.

ABE fermentation can produce some additional ATP

Wobble pairing allows \__________________________. A.    an amino acid to interact with more than one codon B.    a ribosome to recognize more than one tRNA at a particular position C.    the 5’ base of the anticodon to recognize more than one 3’ base of the codon D.    more than one reading frame to be used for translation E.    more than one amino acid to attach to a particular tRNA

the 5’ base of the anticodon to recognize more than one 3’ base of the codon

A gene whose encoded enzyme that constitutively produces cAMP is cloned into E. coli. How would the lac operon be regulated in the transgenic bacterium? A.    It could never be turned on. B.    It would be induced by lactose and repressed by glucose. C.    It would be repressed by lactose and induced by glucose. D.    It would only be repressed by lactose. E.    It would only be induced by lactose.

it would only be induced by lactose

It takes 25 minutes to pasteurize milk at 65ºC, which is the temperature of your hot water at home. You just made pudding with a wooden spoon, and you want to decontaminate the spoon before you use it again. The decimal reduction time for dairy bacteria on the spoon in hot water would be about… A.    2 minutes B.    5 minutes C.    8 minutes D.    25 minutes E.    30 minutes

5 minutes

Why does a bacterial cell have multiple sigma factors? A.    Some sigma factors activate gene transcription while others repress transcription. B.    One sigma factor binds to the leading strand, and one binds to the lagging strand. C.    A different sigma factor is required for each gene. D.    This allows the cell to coordinately transcribe genes with related functions. E.    Some are for transcription while others are for translation.

this allows the cell to coordinately transcribe genes with related functions

Which of the following sequences is considered a palindrome? A.    5’-TATAAT-3’ B.    5’-CCCAAA-3’ C.    5’-CGATCG-3’ D.    5’-AGAAGA-3’ E.    5’-GGAGG-3’

5’-CHATCC-3’

In protein synthesis, the transpeptidation reaction \________________. A.    makes a peptide bond and transfers the protein to the tRNA in the A site B.    makes a peptide bond and releases the protein from the ribosome C.    brings a new tRNA to the A site of the ribosome D.    makes a peptide bond E.    moves the ribosome towards the 5’ end of the mRNA

makes a peptide bond and transfers the protein to the tRNA in the A site

What signals a bacterial cell to end transcription of a gene? A.    The dissociation of the sigma subunit from the rest of the RNA polymerase. B.    A Shine-Dalgarno sequence. C.    A stop codon. D.    A G-C rich hairpin loop followed by a stretch of uracil nucleotides E. The operator sequence of the next operon on the chromosome.

a G-C rich hairpin loop followed by a stretch of uracil nucleotides

What is a reporter gene? A.    A gene with a consensus promoter that is used to define 100% promoter activity. B.    A gene that is inserted into another gene to detect promoter activity. C.    A vector used for oligonucleotide site-directed mutagenesis. D.    A negative regulatory protein that binds to another gene’s operon. E.    A part of a two-component regulatory system.

a gene that is inserted into another gene to detect promoter activity

A prokaryotic mRNA is shown below. How will the codons in this sequence be read? Note: A significant sequence is underlined. 5’-GGCGAACAU__GGAGG__CUAGAUGCACCCUUCGCAGUACGU…-3’ A.    AUG-CAC-CCU-UCG-CAG-UAC-… B.    CUA-GAU-GCA-CCC-UUC-GCA-GUA-CGU-… C.    AUG-UUC-GCC… D.    AUG-GAG-GCU-AGA-UGC-ACC-CUU-CGC-AGU-ACG-… E.    AUG-ACG-CAA-CCC-ACG-UAG-CUA…

AUG-CAC-CCU-UCG-CAG-UAC-…

An inducible gene under positive control is transcribed (“turned on”) \__________________. A.    when an environmental signal prevents a regulatory protein from binding B.    whenever a regulatory protein is translated in the cell C.    when an inducer modifies a regulatory protein to allow the regulatory protein to bind D.    whenever an environmental inducer binds to the promoter to initiate transcription E.    all the time since “inducible” and “positive control” are both positive

when an inducer modifies a regulatory protein to allow the regulatory protein to bind

Place the following steps in order that are used to create a cloning library and find a specific gene in the library. Note: Some of the steps many not be used. 1. Clones are transferred to filter paper. 2. The library is plated onto agar. 3. Clones are screened by colony hybridization. 4. DNA is isolated and incubated with restriction enzymes. 5. Cloned DNA is inserted into the cloning host. 6. DNA is ligated into the cloning vector. 7. Electrophoresis separates DNA fragments. A.    4 – 7 – 5 – 1 – 3 – 2 B.    7 – 4 – 5 – 2 – 3 C.    2 – 1 – 3 – 4 – 7 – 6 – 5 D.    4 – 7 – 3 – 6 – 5 E.    4 – 6 – 5 – 2 – 1 – 3

4-6-5-2-1-3

Which of the following is an example of a biological vector? A.    A worm attaches to the intestinal lining and releases cysts. B.    A mite causes inflammation when it burrows into the skin. C.    A flea must take a blood meal to transmit an infection. D.    A louse carries bacteria which enter the skin when scratched. E.    A fly carries bacterial spores on its legs.

a flea must take a blood meal to transmit an infection

Viruses in the Herpes family are examples of latent viral infections. Which of the following would be true one year after a person is infected with Herpesvirus? A.    Lots of both DNA and capsomeres from Herpes could be detected in the person. B.    Viral DNA could be detected in a person even though viral capsomeres could not. C.    Viral capsomeres could be detected in the person even though viral DNA could not. D.    Small amounts of both DNA and capsomeres from Herpes could be detected in the person. E.    Neither DNA nor capsomeres from Herpes could still be detected in the person.

viral DNA could be detected in a person even though viral capsomeres could not

What is the purpose of cassette switching as a method of gene regulation? A.    To allow the cell to respond to crowding by a high density of other cells. B.    To express gene variants that are otherwise silent. C.    To allow the use of multiple sigma factors at the same time. D.    To allow the cell to switch the promoter sequence between two genes. E.    To allow the cell to turn on multiple genes at the same time.

to express gene variants that are otherwise silent

How do you typically get schistosomiasis (bilharzia)? A.    By eating uncooked or undercooked pork products. B.    By going barefoot in soil contaminated with miracidial larvae. C.    By wading or standing in water that contains cercarial larvae. D.    By coming into contact with fleas carrying schistosome eggs on their leg hairs. E.    By eating food contaminated with schistosome proglottids.

by wading or standing in water that contains cercarial larvae

Symptoms of a plant being infected with a virus include all of the following EXCEPT…. A.    The plant can form tumors are the virus transforms cells. B.    Small lesions can eventually spread to adjacent tissues. C.    Infected plants do not grow as well and are often smaller than normal. D.    Leaves become streaked as dead cells lose their chlorophyll. E.    Holes form in leaves from lysis of epithelial cells.

holes form in leaves from lysis of epithelial cells

\____________ is a low-level disinfectant that damages bacterial cytoplasmic membranes. It is often used in mouthwashes and skin care products. A.    Formalin B.    Ethylene oxide C.    Chlorhexidine D.    Betadine E.    Glutaraldehyde

chlorhexidine

Viruses can be classified by all of the following EXCEPT… A.    whether or not the nucleic acid is segmented B.    capsid morphology C.    type of nucleic acid D.    DNA or RNA replication intermediates E. shape of the lipid envelope

shape of the lipid envelope

Ringworm (Tinea corporis) would most accurately be described as \___________________. A.    diarrhea caused by infection with a flagellated protozoan B.    a respiratory infection acquired by inhaling spores of a dimorphic fungus C.    skin colonization by a cutaneous fungus D.    an allergic reaction to flat worm infestation of the skin E.    a nematode infection of the intestine

skin colonization by a cutaneous fungus

What is a PAMP? A.    A type of phagocyte that is specialized for engulfing viruses and prions. B.    A disease in which blood begins to clot in capillaries leading to organ failure. C.    A molecule on the surface of a bacterium to which phagocytes bind. D.    A type of cytokine for T cell activation. E.    A macrophage surface protein to which bacteria bind specifically.

a molecule on the surface of a bacterium to which phagocytes bind

It is now easy to make mutations in any bacterial gene we choose. What technique can we use to make designer mutations? A.    Southern blotting of cloning vectors B.    Microarrays with labeled cDNA from two different species C.    Colony hybridization with radioactive probes D.    Restriction digestion with two different enzymes E.    Probes with sequence mismatches used as replication primers

probes with sequence mismatches used as replication primers

A traveler to Brazil is given a prescription for chloroquine. Why? A.    Coccidiodomycosis in endemic to Brazil, and he will probably inhale the spores. B.    If he plans to go barefoot on the beach, this will prevent him from getting schistosomiasis. C.    He may be exposed to malaria while in Brazil, and this will prevent an infection. D.    He probably has a viral infection that he might spread to other people on the plane. E.    He does not want to get bacterial diarrhea from the food he will eat.

he may be exposed to malaria while in Brazil, and this will prevent an infection

One advantage of the Kirby-Bauer test compared to the MIC testing is that the Kirby-Bauer test \____________________________. A.    can determine the toxic dose of an antibiotic as well as the therapeutic dose B.    provides results in minutes rather than hours required for MIC testing C.    is cheaper and easier to perform in a clinical setting D.    can determine the MIC from multiple antibiotics simultaneously E.    is more accurate

is cheaper and easier to perform in a clinical setting

The inflammatory response \___________________________________. A.    results in a large increase in blood pressure and volume B.    can only occur in response to bacterial replication in the body C.    involves constriction of capillaries to reserve blood for vital organs D.    causes leukocytes to adhere to, and then leak through, blood vessel walls E.    involves mainly the adaptive immune response rather than the innate

causes leukocytes to adhere to, and then leak through blood vessel walls

Which of the following would be LEAST likely to be found on an R-plasmid? A.    Genes encoding ergosterol synthase B.    Genes encoding the structural proteins of a pilus C.    Genes encoding a mutant form of DNA gyrase D.    Genes encoding beta lactamase E.    Genes encoding a Type I secretion system

genes encoding ergosterol synthase

What is the unique step in the life cycle of a retrovirus? A.    A mechanism by which new virions are released from the cell B.    Viral latency within host cells C.    Use of a polyprotein protease during assembly D.    Entry into the cell by endocytosis E.    Production of an RNA/DNA hybrid during replication

production of an RNA/DNA hybrid during replication

Cytokines called interleukins are responsible for \__________________________. A.    chemotaxis of macrophages, death of viruses, and maturation of leukocytes B.    recruiting erythrocytes, platelets, and goblet cells C.    inflammation, apoptosis, and death of infected cells D.    fever, inflammation, and leukocyte maturation E.    killing tumor cells, viruses, and infected host cells

fever, inflammation, and leukocyte maturation

Which complement molecule is correctly matched with its function? A.    C3a – an opsonin that binds to bacteria B.    C3b – lyses infected cells C.    properdin – stimulates the inflammatory response D.    C5b – part of a protease E.    C5a – chemokine signaling molecule

C5a- chemokine signaling molecule

How are helper T (TH) cells involved in the humoral immune response? A.    Cytokines release from TH cells cause B cells to turn into antibody-producing plasma cells. B.    TH cells kill infected cells by releasing perforin and inducing apoptosis. C.    Antibodies are modified by TH cells so that they are reactive. D.    Macrophages produce antibodies in response to TH cells. E.    TH cells produce antibodies.

cytokines release from TH cells cause B cells to turn into antibody-producing plasma cells

What is the role of regulatory T (Treg) cells in the immune response? A.    Treg cells secrete regulatory antibodies that limit the body’s autoimmune responses. B.    Treg cells stimulate the interaction between cytotoxic T (TC) cells and NK cells. C.    Treg cells regulate B cell clonal expansion in the absence of nearby macrophages. D.    Treg cells produce the cytokine IL-2 to stimulate TC cell differentiation. E.    Treg cells produce the cytokine IL-10 to reduce the effectiveness of TH and TC cells.

T reg cells produce the cytokine IL-10 to reduce the effectiveness of TH and TC cells

What is an adjuvant? A.    A young lymphoid stem cell before it becomes either a TH or a TC cell. B.    A substance that must be added to live vaccines to attenuate them. C.    A substance in some vaccines that helps to elicit a cellular immune response. D.    A type of vaccine in which nucleic acid (DNA/mRNA) is injected into your cells. E.    A toxin that has been inactivated by formaldehyde crosslinking.

a substance in some vaccines that helps to elicit a cellular immune response

Which of the following antibody types is correctly matched with a feature of that antibody? A.    IgG – first Ig produced in response to an infection B.    IgA – can cross the placenta to protect a developing fetus C.    IgM – only Ig produced in response to T-independent antigens D.    IgE – long half life allows long-term protection from circulating pathogens IgD – FC part dimerizes to allow additional agglutination sites

IgM- only Ig produced in response to T-independent antigens

Which of the following does not use two antibodies, one labeled and one unlabeled? A.    Immunodiffusion test B.    Indirect fluorescent antibody test C.    Indirect ELISA test D.    Direct ELISA test E.    Western blot (Immunoblot)

immunodiffusion test

What is the function of a Toll-like receptor (TLR)? A.    It allows the immune system to recognize when a viral infection has occurred. B.    It allows bacteria to bind to the FC part of antibodies. C.    It allows pathogens to bind specifically to epithelial cells. D.    It allows TH cells to bind specifically to B cells. E.    It allows macrophages and dendritic cells to bind specifically to pathogens.

it allows macrophages and dendritic cells to bind specifically to pathogens

The protein called B7 is produced by \___________ to ensure that an immune response is only produced in response to the presence of a pathogen. A.    all cells with nuclei B.    bacteria C.    dendritic cells D.    B cells E.    TH cells

dendritic cels

When we say that a patient has a “disseminated” bacterial infection, what can we assume? A.    It is an infection of the disseminate, an accessory part of the digestive system. B.    The infection is transmitted by the airborne route. C.    The patient is suffering from an autoimmune sequelae. D.    The patient has or had bacteremia. E.    The bacteria were transmitted in sexual secretions as an STI.

the patient has or had bacteremia

What happens during the process called “clonal deletion”? A.    B cells that fail to recognize a T-cell receptor lose their ability to be activated. B.    B cells undergo apoptosis if their receptors recognize proteins present in bone marrow. C.    B cells that have bound to repeating antigen release surface receptors as antibodies. D.    Variable genes are joined to diversity genes by joining segments to expand antibody diversity. E.    B cells that have bound to an antigen turn into plasma cells.

B cells undergo apoptosis if their receptors recognize proteins present in bone marrow

How does a Type III hypersensitivity reaction damage your tissues? A.    Helper T (TH) cells direct the release of mediators that cause fluid leakage from capillaries. B.    Infectious organisms survive within macrophages causing inflammation. C.    Complement activation in capillaries recruits PMNs (neutrophils) which secrete perforin. D.    Macrophages recruited to the site of an infection start to digest your own cells. E.    Misdirected cytotoxic T (TC) cells and helper T (TH) cells kill your own cells.

complement activation in capillaries recruits PMNs (neutrophils) which secrete perforin

The malaria parasite spends most of the human part of its life cycle in red blood cells (RBCs). What does this imply about the body’s response to the presence of this parasite? A.    The parasite’s surface proteins resemble those of the host. B.    The parasite is not exposed to either humoral or cellular immune responses. C.    The parasite can be neutralized by antibodies once the antibodies bind to RBCs. D.    Infected RBCs can only be killed by NK cells. E.    Antibodies cannot bind to the parasite, but cytotoxic T (TC) cells can still kill infected RBCs.

the parasite is not exposed to either humoral or cellular immune response

Which of the following is a difference between endogenous and exogenous antigen presentation? A.    Endogenous antigens are displayed only on professional APCs. B.    Endogenous antigens are always “self”, while exogenous antigens are “foreign”. C.    Endogenous antigens bind to the T-cell receptor (TCR) of a helper T (TH) cell. D.    MHC-II presents only endogenous antigens. E.    Endogenous antigens are processed by the proteasome while exogenous antigens are collected from the phagolysosome.

endogenous antigens are processed by the proteasome while exogenous antigens are collected from the phagolysosome

According to the “hygiene hypothesis”, \_________________________________________. A.    washing hands appropriately is the single best way to reduce disease transmission B.    childhood illness leads to a more robust immune response as an adult C.    lack of exposure to gut flora leads to fewer Treg cells and more autoimmune disease D.    being “too clean” leads to death of your native flora E.    you need some good bacteria to fight off the bad ones

lack of exposure to gut flora leads to fewer T reg cells and morre autoimmune disease

Which of the following is true for a direct ELISA but not for an indirect ELISA? A.    The test can be made more sensitive by conjugating latex beads the known antigen. B.    The test can be used to detect a latent infection. C.    Anti-Fc secondary antibodies are used to detect the primary antibodies. D.    The test uses an enzyme reaction to visualize antibodies. E.    To begin the test, known antibodies are bound to the bottom of a microtiter well.

to begin the test, known antibodies are bound to the bottom of a microtiter well

A new virus is discovered. It is airborne, has a reservoir in geese, has a high ID50 for humans, has a segmented genome, and has not yet evolved balanced pathogenicity. Which part of this information is good news, and why? A.    The virus reservoir is geese. That makes it potentially easy to eradicate. B.    The virus genome is segmented. That allows you to break it up more with a vaccine. C.    The virus has a high ID50. It will take a lot of the virus to kill you. D.    The virus has airborne transmission. You can avoid it by stay 1 meter away from other people. E.    The virus is not a balanced pathogen. At least it has not evolved to become as deadly as it could be.

the virus has a high ID 50, it will take a lot of the virus to kill you

Type I (juvenile-onset) diabetes is caused by which of the following? A.    Antibodies that recognize a person’s own DNA. B.    A Type II hypersensitivity reaction involving maternal antibodies. C.    Self-recognizing cytotoxic T (TC) cells that have not been deleted. D.    A Type III autoimmune sequela to a bacterial infection. E. A congenital viral infection.

self-recognizing cytotoxic T (Tc) cells that have not been deleted

Which of the following may appear in many places in the body, all of which usually involve biofilms, often with a green pigment, forming an inadequately protected tissues? A.    Pseudomonas B.    Impetigo C.    Staphylococcus D.    Gangrene E.    Lyme disease

Pseudomonas

Which of the following invasion and colonization (I/C) factor is correctly matched with its role in an infection? A.    IgA protease – allows a bacterium to cause bacteremia B.    Coagulase – alters the membrane structure of eukaryotic host cells C.    Type III effectors – prevent uptake of bacteria by host cells D.    Fimbriae – injected into a host cell and damage its cytoskeleton E.    Siderophore – steals iron from the eukaryotic host

siderophore- steals iron from the eukaryotic host

In a T-dependent B cell response, \__________________________________________________. A.    somatic recombination occurs but not clonal deletion B.    a T-cell receptor (TCR) must bind to CD8 on the B cell surface C.    a B cell must endocytose an antigen and present it on MHC-II D.    a B-cell receptor (BCR) must interact with a T-cell receptor (TCR) E.    multiple B-cell receptors are crosslinked by an antigen

a B cell must endocytose an antigen and present it on MHC-II

How could you tell if a particular pathogen produced a superantigen toxin when it infected a patient? A.    Look for a larger than normal antibody titer against the pathogen. B.    Look for the release of cytokines from helper T (TH) cells that do not recognize the pathogen. C.    Look for tissue damage in a patient. Only superantigen toxins can do that. D.    Look for complete clearing when the pathogen is grown on a blood agar plate. E.    Look for symptoms of disseminated intravascular coagulation (DIC). Any pathogen that causes DIC probably produces a superantigen toxin.

look for the release of cytokines from helper T (TH) cells that do not recognize the pathogen

Which of the following can be killed by natural killer (NK) cells? A.    Any lymphocyte that is displaying a foreign antigen. B.    Any cells that lacks MHC-I or has antibodies bound to it. C.    Only tumor cells. D.    Only foreign parasites circulating in the blood. E.    Dendritic cells after they have engulfed a pathogen.

any cell that lacks MHC-I or has antibodies bound to it

What does it mean for a disease to be a “notifiable” disease? A.    The disease spreads so quickly that new cases must be placed in quarantine. B.    The disease is unusual enough that new cases are often reported in medical journals. C.    The disease is serious enough that each case must be reported to the authorities. D.    The symptoms are so painful that you know right away when you get sick. E.    The signs and symptoms are so obvious that the disease can be diagnosed quickly.

the disease is serious enough to each case must be reported to the authorities

If you travel to Russia and return with a case of diphtheria, the doctor will likely give you a shot of diphtheria immune globulin (DIG). What is that? A.    A passive antitoxin B.    An active form the diphtheria antigen C.    A toxoid vaccine D.    An injected antibiotic E.    An antibody against a bacterial surface protein

a passive antitoxin

How are bacterial Type III secretion system effectors involved in causing disease? A.    They bind host cell receptors and are internalized like toxins. B.    The mimic “cancel kill” signals so NK cells do not kill infected host cells. C.    They are leukocidins that the bacterium uses to kill phagocytes. D.    The allow the bacterium to compete with the host for binding iron. E.    The rearrange the host cell cytoskeleton and allow the bacterium to enter host cells.

the rearrange the host cell cytoskeleton and allow the bacterium to enter host cells

During some viral infections, infected cells fuse to form \_________ because \________________. A.    syncytia ; it allows for more efficient assembly of new viral particles B.    syncytia ; it allows the virus to avoid serum antibodies C.    granulomas ; these “activated” cells have a more potent oxidative burst D.    granulomas ; infected macrophages continue to secrete cytokines E.    giant cells ; these cells are easier from the immune system to recognize

syncytia: it allows the virus to avoid serum antibodies