Module 3 Foundational Scientific Knowledge

What does DNA stand for?

Deoxyribonucleic Acid

What is the genetic material of organisms?

DNA

What is the structure of DNA?

Usually double stranded

What sugar is present in DNA?

Deoxyribose

What are the four nucleobases found in DNA?

Adenine, thymine, cytosine, and guanine

Common sources of DNA

Blood (white cells), semen (sperm cells; the head), saliva (epithelial cells), sweat (epithelial cells), and hair roots, bone (osteoblast), teeth (all vascular regions).

Why is DNA important to forensic science?

DNA is important to forensic science because it is highly stable in stains. Found in almost all human cells, and extremely polymorphic, and therefore statistically highly informative for the purpose of establishing sample origin. It is extremely sensitive, reproducible, and reliable.

Where is DNA commonly found in humans?

DNA is found in almost all human cells.

What makes DNA statistically informative in forensics?

DNA is extremely polymorphic, making it statistically highly informative for establishing sample origin.

What are the two types of bonds in DNA?

Hydrogen bonds and Phosphodiester bonds.

How many hydrogen bonds are formed between adenine and thymine?

Two hydrogen bonds.

How many hydrogen bonds are formed between guanine and cytosine?

Three hydrogen bonds.

What type of bond forms the sugar-phosphate backbone of DNA?

Phosphodiester bonds.

What do phosphodiester bonds connect in DNA?

The deoxyribose sugar of one nucleotide and the phosphate group of the next.

Complementary base pairs in DNA

A-T and C-G

PCR denaturation

The process where hydrogen bonds holding the two strands of DNA together are broken by elevated temperature or chemical treatment.

What is the Quantitation Real Time PCR method?

A method used to quantify DNA in real-time during the PCR process.

What lab procedure is dependent on the melting temperature of the DNA of interest?

PCR denaturation, the hydrogen bonds holding the two strands of DNA together through base pairing may be broken by elevated temperature or by chemical treatment and also Quantitation Real Time PCR

G/C rich regions

Have three hydrogen bonds, resulting in a higher melting temperature.

What are the A/T rich regions, how many bonds, and does it have a lower or higher melting temperature?

Regions of DNA that have a higher number of adenine (A) and thymine (T) bases, which have two hydrogen bonds, resulting in a lower melting temperature.

How many base pairs are in human nuclear DNA?

Over 3 billion base pairs (bp)

What percentage of base pairs are the same in all humans?

Over 99.7%

What percentage of base pairs differ between individuals?

Around 0.3%

What makes individuals unique in terms of DNA?

The 0.3% of base pairs that differ between people

Who has unique DNA?

With the exception of identical twins, the DNA of each individual is unique and inherited from parents, with half coming from the mother and half from the father.

Types of mutations

Insertion, Deletion, and Substitution.

Insertion mutations

Mutations where extra base pairs are inserted into a new place in the DNA.

Deletion mutations

Mutations in which a section of DNA is lost or deleted.

Substitution mutations

Mutations where a single nucleotide is replaced by another.

Genetic inheritance

The passing of genetic material, specifically DNA, from parents to offspring, including traits and health conditions.

What is genetic variation during meiosis due to?

Genetic variation in offspring is due to independent assortment, recombination, and random fertilization.

Describe the mechanism during meiosis that lead to genetic variation in offspring

During fertilization, one gamete from each parent combines to form a zygote. Because of recombination and independent assortment in meiosis, each gamete contains a different set of DNA. Resulting in a unique combination of genes in the resulting zygote.

Independent assortment

The random distribution of homologous chromosomes to daughter cells, resulting in unique combinations of chromosomes in gametes.

Recombination

The process during prophase of meiosis where crossing-over leads to new combinations of genes on each chromosome.

Random fertilization

The random fusion of gametes produced by meiosis during sexual reproduction, introducing genetic variation.

Friedrich Miescher

The scientist who first identified DNA in the 1860s.

Karl Landsteiner

The scientist who distinguished the main blood groups in 1900.

Watson and Crick

The scientists who discovered that DNA is a three-dimensional double helix in 1953.

Southern blotting

A method used for the detection of DNA polymorphisms, developed in 1978.

Kary Mullis

The scientist who discovered PCR in 1983, a method that amplifies specific regions of DNA.

Alec Jeffreys

The scientist who discovered DNA repeat sequences in 1985, enabling human identity tests.

Colin Pitchfork

The first murderer convicted using DNA profiling in 1986.

When Real time PCR was invented?

A method developed in 1992 for quantifying DNA in real-time during PCR.

Phenotype

Observable characteristic of a cell or organism. Physical appearance

Genotype

The genetic makeup of an individual, including all alleles inherited from parents.

Intron

A noncoding DNA which separates neighboring exons in a gene; intron sequences are removed during transcription so that only exons contribute to gene expression.

Exon

A segment of a gene that is represented in the final mRNA product

Histone

A protein that provides structural support for a chromosome having a molecular weight of approximately 11,000 to 21,000 Daltons.

mtDNA

Circular DNA molecules contained within the mitochondria of a cell and maternally inherited

Nuclear DNA

Linear DNA wrapped around histones, located in the nucleus of eukaryote cells, and inherited equally from both parents

Polymorphism

Variations in DNA sequences among individuals.

What is Restriction Fragment Length Polymorphisms (RFLPs)?

Differences or variations among people in their DNA sequences at sites recognized by restriction enzymes.

Single Nucleotide Polymorphisms (SNPs)

Genomic variant at a single base position in the DNA; a one-letter place where your genome varies from another genome sequence.

Molecular Probe

A single-stranded sequence of DNA or RNA used to search for its complementary sequence in a sample genome.

RFLP Testing

Restriction fragment length polymorphism, a molecular marker technique that detects variations in DNA sequences by digesting DNA with restriction enzymes.

What is an advantage of STR PCR testing regarding DNA template amount?

Very small amounts of DNA template may be used.

Can degraded DNA serve as a template for STR PCR testing?

Yes, DNA degraded to fragments only a few hundred base pairs in length can serve as an effective template for amplification.

What is a benefit of multiplex PCR reactions in STR PCR testing?

Large numbers of copies of specific DNA sequences can be amplified simultaneously.

How does STR PCR testing compare in speed?

It is faster.

What is a disadvantage of STR PCR testing related to PCR inhibitors?

The target DNA template may not amplify due to the presence of PCR inhibitors.

How can sequence mutations affect STR PCR testing?

Amplification may fail due to sequence mutations in the primer binding region.

What contamination issue can occur in STR PCR testing?

Contamination from other human DNA sources is possible.

What are stutter products in STR PCR testing?

Stutter products are artifacts that can occur during amplification, leading to imbalanced peak heights.

Are CODIS Core STR Loci transcribed or translated?

Typically non-coding regions of the genome that are NOT transcribed or translated into proteins.

Why was the core STR Loci chosen?

Chosen specifically because they are highly variable among individuals but do not code for proteins, making them useful for forensic identification without affecting the individual's phenotype

Complementary DNA Sequence

For the sequence 5'-ACGGTATGGA-3', the complement is 3'-TGCCATACCT-5'.

What is Capillary Electrophoresis?

A method used to differentiate alleles based on their size, causing them to migrate at different rates.

(TCGT)8 Allele

TCGTTCGTTCGTTCGTTCGTTCGTTCGTTCGT with allele call 8.

(TCGT)9 Allele

TCGTTCGTTCGTTCGTTCGTTCGTTCGTTCGTCGT with allele call 9.

(TCGT)5TCG(TCGT)3 Allele

TCGTTCGTTCGTTCGTTCGTTCGTCGTTCGTTCGT with allele call 8.3.