Microbiology Unit 3

Which of the following are components of a nucleotide?

-a five carbon sugar

-phosphate group

-nitrogenous base

Place the proteins involved in DNA replication in the correct order in which they act.

1- helicase

2- single strand binding proteins

3- primase

4- DNA polymerase III

5- DNA polymerase I

6- Ligase

The parental strand of DNA that the leading strand is built on must be in the ________________ orientation.

3' to 5'

DNA polymerase can only lay down nucleotides in the _______________ orientation.

5' to 3'

The lagging strand is synthesized __________________.

discontinuously

In RNA Adensine always pairs with _____________.

Uracil

The following describes intiation of which process?

A ribosome binds to an mRNA transcript and scans until it reaches the start codon. Once the start codon is reached the corresponding tRNA carries the amino acid Methionine to the ribosome where is will be the first amino acid in the growing peptide chain.

translation

For initiation of this process, RNA polymerase binds to a TATA box found in the promoter region of a gene and begins laying nucleotides.

transcription

complexes with proteins to make up the ribosomal subunits

rRNA

carries amino acids from the cytoplasm to the ribosome for insertion into the growing polypeptide chain

tRNA

carries the genetic message or blueprints with the instructions or codons that determine the order of amino acids that will compose the polypeptide

mRNA

DNA polymerase can be considered a "high maintenance" enzyme as it CANNOT do the following things that RNA polymerase CAN do.

-break hydrogen bonds between the DNA strands

-lay down nucleotides without a free hydroxyl group on the end of a primer

All three types of RNA used by a prokaryotic or eukaryotic cell for translation are made via the process of

transcription

Which type of horizontal gene transfer requires contact between the donor and recipient bacteria?

Conjugation

All organisms can do __________ gene transfer where information is transferred from parent to progeny. In addition, bacteria can also do ____________ gene transfer where information is transferred between bacteria of the same generation.

Vertical, horizontal (lateral)

Which form of horizontal (lateral) gene transfer depends on a virus that infects bacteria to transfer genetic information?

Transduction

What are competent cells?

Cells able to take up naked DNA from the environment

In a culture of 50 F+ Escherichia coli and 50 F- Escherichia coli, given an adequate amount of time

All cells would be F+

In generalized transduction

Random genes are transferred

The enzyme ___________ is used in ________________ to seal the nick left in the sugar-phosphate backbone of the newly made DNA strand.

Ligase, replication

___________ bonds which hold the two parental strands of DNA together are broken by ___________ during replication of DNA.

Hydrogen, Helicase

Prokaryotic replication, transcription and translation all happen in the __________________. Eukaryotic replication and transcription happen in the ______________ while translation happens in the ___________.

Cytoplasm, nucleus, cytoplasm

A virus is always made up of

-capsid

-genome

The following components are found on some but not all viruses.

-enzyme

-envelope

Order the steps in viral replication.

1. absorption

2. penetration

3. synthesis

4. maturation

5. release

Which step of replication differs the most between an animal RNA and an animal DNA virus?

synthesis

Which two steps in bacteriophage replication use the enzyme lysozyme?

-absorption

-penetration

-release

Select the way(s) that describe how an animal virus can enter or penetrate a host cell.

-endocytosis

-membrane fusion

A retrovirus uses a RNA dependent DNA polymerase called __________________ to make DNA from an RNA template.

reverse transcriptase

Once injected into a host cell, the genome of a virus with negative sense RNA can be directly read and translated into protein by the host cell ribosomes.

false

A virulent virus has a lysogenic relationship with the host cell while a temperate virus has a lytic infection relationship with the host cell.

false

Viruses have a genome made up of RNA or DNA, but not both RNA and DNA.

true

Uncoating is a necessary step for bacteriophage, but not animal viruses.

false

Viruses can be described as

acellular

If an organism had a genome (DNA) made up of 60,000 base pairs, and you know that there are 18,000 Cytosine, how many Thymine are there?

42,000

What is the protein (amino acid sequence) that would result from this piece of DNA? You will need to use the Genetic Code below.

3'ACGCATACCGTTAGGAACTTCTGACTCGC 5'

Met-Ala-Ile-Leu-Glu-Asp

In Deoxyribonucleic acids, the nucleotide cytosine always base pairs to

Guanine

A linear sequence of DNA nucleotides which provides the genetic information for a single characteristic (protein) is a

Gene

A permanent alteration or change in the DNA of an organism is called a(n)

Mutation

Transcription is the formation of ___________from a __________ template.

RNA, DNA

Reverse transcription is performed by

only some viruses

There are viruses known to infect

all organisms

Okasaki fragments make up

Part of the lagging strand of newly synthesized DNA

Viral nucleic acid is

either DNA or RNA

Which of the following traits does not apply to viruses?

Isolated viruses perform their own metabolism.

Prokaryotic and eukaryotic DNA is similar in which way?

The genome is composed of double stranded, helical DNA.

Bacteriophage _______________________ while animal viruses do not.

use lysozyme to weaken the host cell wall

Which enzyme is needed to initiate transcription?

RNA Polymerase

Animal viruses enter a cell

by endocytosis

Which of the following increases the genetic diversity of bacteria?

-transduction

-mutation

-transformation

The genetic information needed for a cell to participate in conjugation resides in the DNA of a cell's

F plasmid

A prokaryotic cell

is able to perform transcription and translation at the same time

Reverse transcription results in the formation of what type of new molecule?

DNA

During DNA replication

the leading strand is synthesized in the 5' to 3' direction

An anticodon is a part of

tRNAs

In eukaryotes, transcription takes place in the ____________ while translation takes place in the ____________ .

nucleus, cytoplasm

Which of the following statements is true?

DNA polymerase lays nucleotides in the 5' to 3' direction

Positive sense RNA

can be used to create a functional protein by the host cell ribosomes

A negative sense RNA animal virus

inserts an enzyme along with the genome into the host

Prions

are misfolded, infectious proteins

____ breaks the hydrogen bonds between the two parental strands of DNA._____ keeps the parental strands from rebonding back together._____ attaches to the parental template and lays a short sequence of complementary RNA nucleotides. This leave a free 3' hydroxyl (OH) group that____ needs in order to lay the bulk of the complementary DNA nucleotides. Once complete, the primer RNA nucleotides must be removed by_____ and replaced with DNA nucleotides. Finally ligase comes in to seal the nick left in the_____ of the newly synthesized leading strand of DNA. In a prokaryotic cell, all the steps of replication occur in the_____ while in a eukaryotic cell they occur in the______

-Helicase

-Single strand binding proteins

-primase, rna primase

-dna polymerase III

-dna polymerase I

-sugar phosphate backbone

-cytoplasm

-nucleus

_____ ._____ complexes with proteins to make up the two ribosomal subunits._____ carries the copy of the genetic message from the DNA to the ribosome. It also has_____ which are groups of three nucleotides that code for each amino acid that will make the new protein chain._____ has an anticodon on one end and an amino acid binding site on the other. It carries the amino acids to the______, the site of protein synthesis, for incorporation into the new polypeptide chain.

-transcription

-rRNA

-mRNA

-Codons

-tRNA

-ribosome

_____ gene transfer. Besides transfer from parent to progeny, bacteria can also transfer genes to other unrelated bacteria. This is referred to as_____ gene transfer. The only method of gene transfer where the donor and recipient bacterial cells come in contact with each other is_____. A pilus connects the two cells and large amounts of genetic information can be transferred. Genes can also be transferred between bacterial cells using a virus. This is called_____ and can be generalized or specialized. The last type of gene transfer happens when DNA released from one bacterial cell into the environment is taken up by another bacterial cell. This is called_____ and was discovered by Griffith.

-vertical

-horizontal

-conjugation

-transduction

-transformation

____ cycle. Temperate viruses infect, insert their genetic information into the chromosome of the host cell, and do not destroy the host cell in the process. This is called the_____ cycle. No matter if it is virulent or temperate, the first step in viral replication is _____ where the virus attaches to its host cell via special proteins called spikes or via the capsomeres that make up the capsid. The next step is_____ where the virus goes from being attached outside the cell to getting inside of the cell. Next, if the virus is virulent then it will use the host enzymes, energy, and biological molecules to make new virus proteins and nucleic acids in the step called_____. The new viral proteins and nucleic acids are combined in the step called _____ to make complete virions. Finally, the new viruses must leave the cell in the final step called _____. Enveloped viruses leave the cell via ______ while naked viruses must lyse the host cell.

-lytic

-lysogenic

-adsorption

-penetration

-synthesis

-maturation

-release

-budding

Viruses can be classified as naked or enveloped. Define the terms naked and enveloped. Give one advantage to being a naked virus and give one advantage to being an enveloped virus.

Naked-does not have an envelope. Advantage-can live outside longerEnveloped-has an envelopeAdvantage-Not easily found

This RNA virus belongs to the family Flaviviridae and is often transmitted to humans via a mosquito vector. Infection was previously endemic and mainly affected monkeys in tropical climates. The reason(s) for the recent increase in transmission to humans are unknown, but there is growing concern that infection with the virus can cause birth defects when a pregnant woman becomes infected.

Zika Virus

This RNA virus belongs to the family Rhabdoviridae. It has a very extensive host range and is known to infect most mammals. It is commonly transmitted from one host to another via a bite wound. It replicates in nervous tissue and must be treated immediately following transmission or chances of survival are almost zero.

Rabies Virus

This DNA virus is a member of the family Hepadnaviridae. Infection happens when an individual is exposed to infected blood (via the birthing process if the mother is infected, being bitten by an infected child in a daycare setting, sharing needles, sexual transmission, or when caring for an infected individual.) Infection may be acute or chronic and cause short term or long term liver damage. There is a vaccine that is recommended for infants in the first few days of life.

Hepatitis B Virus

This family of DNA viruses is enveloped and causes latent infections (for example: Chicken Pox and Shingles.) Initial infection causes illness and visible symptoms. The virus is then not eliminated from the body, rather the genetic information is inserted into the genetic information of the host's nerve cells where it remains and retains the potential to cause symptoms again.

Herpes Virus

This virus is in the family Paramyxoviridae and contains negative sense RNA. It is highly contagious and spreads via respiratory droplets. It begins with a rash on the face that quickly spreads to the rest of the body. Complications like pneumonia are common. This virus can be prevented with the MMR vaccination.

Measles Virus

This DNA virus infects the skin. Most infections are silent and cause no symptoms while some will cause visible warts. Infection with this virus has been associated with 70% of all cervical cancers as well as oral and penile cancers. There is a vaccine available that is now available to both men and women.

Human Papilomavirus

This RNA virus belongs to the family Picornaviridae. It infects via the fecal-oral route and outbreaks, while rare now in the US, were once very common in the summer months in under chlorinated public pools. The virus is typically confined to the digestive tract, but in rare cases can spread to the nervous system and lead to paralysis. Infection can be prevented with vaccination, but it is still common in countries that do not have a vaccination program in place.

Polio Virus

This RNA virus belongs to the family Filoviridae because under an electron microscope it looks like a string with a few loops at the top. It causes a very serious systemic illness with eventual internal and external bleeding and has an extremely high mortality rate. It is mostly endemic to Africa, but in recent years, cases have popped up in other countries including the US.

Ebola Virus

This RNA virus belongs to the family Orthomyoviridae. It has a broad host range and can infect humans, swine, fowl, and even whales. This gives the virus many chances to change its genetic information and hence change the H and N glycoproteins on its surface. Because it changes its appearance so often, a new yearly vaccine is recommended.

Influenza Virus

This virus is a RNA retrovirus that carries its own enzyme, reverse transcriptase. Reverse transcriptase is able to transcribe the viral RNA into DNA which can then be used by the host cell to direct viral replication. The virus lives and multiplies in the white blood cells of the host, eventually killing them. The result is that the host is immunocompromised and susceptible to many other infections.

Human Immunodeficiency Virus