BIOL 1201 Exam 3; The Molecular Basis of Inheritance

Thomas Hunt Morgan's group (biochemist)

When _________ group showed that genes are located on chromosomes, the two components of chromosomes—DNA and protein— became candidates for the genetic material

by studying bacteria and the viruses that infect them

How was the role of DNA in heredity first discovered?

- The discovery of the genetic role of DNA began with research by Frederick Griffith in 1928.

- Griffith mixed a heat-killed, pathogenic strain of bacteria with a live, harmless strain and injected this into a mouse.

- The mouse died, and Griffith recovered the pathogenic strain from the mouse's blood.

- He called this phenomenon transformation

How did the discovery of genetic role of DNA began and how?

Transformation

a phenomenon now defined as a change in genotype and phenotype due to the assimilation of external DNA by a cell

Oswald Avery

American bacteriologist that focused on the three main candidates as the transforming substance: DNA, RNA, and protein.

○ Avery broke open the heat-killed, pathogenic bacteria and extracted the cellular contents.

○ He used specific treatments that inactivated each of the three types of molecules and then tested the ability of each sample to transform harmless bacteria.

○ Only DNA was able to bring about transformation.

○ Conclusion: DNA is the genetic material responsible for transformation.

How did Oswald Avery study transforming substances?

a polymer of nucleotides.

DNA is...

▪ A nitrogenous base

▪ A sugar (deoxyribose)

▪ A phosphate group

Each nucleotide consists of three components:

Nucleotide

The building block of a nucleic acid, consisting of a five-carbon sugar covalently bonded to a nitrogenous base and one to three phosphate groups.

▪ Adenine (A)

▪ Thymine (T)

▪ Guanine (G)

▪ Cytosine (C)

What are the four types of bases in DNA?

Erwin Chargaff's Discovery (1950)

Discovery that's key finding was the composition of DNA (proportion of bases) varies between species, suggesting a link between DNA and genetic diversity.

Chargaff's Rules

Two findings from Chargraff that state

o The base composition of DNA varies between species

o In any species the number of A and T bases is equal and the number of G and C bases is equal

Simplified Formula:

• A = T

• G = C

What is the formula for DNA composition according to Chargaff's rules?

Maurice Wilkins and Rosalind Franklin

• Franklin produced a picture of the DNA molecule using this technique

- used a technique called X-ray crystallography to study molecular structure

- ______ produced a picture of the DNA molecule using this technique

- allowed James Watson to deduce that DNA was helical

- Franklin had concluded that there were two outer sugar-phosphate backbones, with the nitrogenous bases paired in the molecule's interior

What was the impact of Rosalind Franklins' s X-ray crystallographic images?

Double-helix

The form of native DNA, referring to its two adjacent antiparallel polynucleotide strands wound around an imaginary axis

Antiparallel

Of a DNA model, meaning that their subunits run in opposite directions

Watson and Crick

- Developed the double helix model of DNA.

- At first, _________- thought the bases paired like with like (A with A, and so on), but such pairings did not result in a uniform helix width.

• Instead, pairing a purine (A or G) with a pyrimidine (C or T) resulted in a uniform width consistent with the X-ray data

- reasoned that the pairing was more specific, dictated by the base structures

thymine (T)

Adenine (A) paired only with ______

cytosine (C)

guanine (G) paired only with _______

DNA replication

The process by which a DNA molecule is copied; also called DNA synthesis.

Watson and Crick's Second Paper

- A paper that published a hypothesis explaining how DNA replicates.

- Core Idea: • Because the two strands of DNA are complementary, each strand can act as a template for creating a new complementary strand when the two strands separate.

Process of Base Pairing to a Template Strand

• When the DNA double helix unwinds, each strand serves as a template for the addition of complementary bases.

• The order of bases on one strand determines the sequence of bases added to the new strand.

What process is this?

• This process duplicates the base pairs exactly, producing two identical copies of the original (parental) DNA molecule.

What is the result of the Process of Base Pairing to a Template Strand?

The Semiconservative Model of Replication

- Proposed by: Watson and Crick - Prediction: • When DNA replicates:

▪ Each daughter molecule consists of one parental (old) strand and one newly synthesized strand.

• This model is called semiconservative replication because half (semi) of the original molecule is conserved in each new molecule.

Semiconservative Replication

— each new DNA molecule consists of one parental (old) strand and one newly synthesized strand

Conservative Model

A DNA model where:

• The two parental strands come back together after replication.

• The result is one completely old molecule and one completely new molecule.

Dispersive Model

A DNA model where:

• Each of the four DNA strands after replication contains a mixture of old and new DNA segments. • The parental molecule is dispersed among the daughter molecules

Meselson-Stahl Experiment

An experiment:

- Researchers: Matthew Meselson and Franklin Stahl (late 1950s)

- Tested and confirmed which of the three proposed models of DNA were correct

- The correct one was semiconservative model proposed by Watson and Crick.

• Used nitrogen isotopes to distinguish between old and new DNA strands.

• The old (parental) DNA strands were labeled with heavy nitrogen (¹⁵N).

• The newly synthesized DNA strands were labeled with light nitrogen (¹⁴N).

• After replication, the DNA samples were spun in a centrifuge, which separates molecules by density.

How did Matthew Meselson and Franklin Stahl conduct their replication experiment?

First Replication (in ¹⁴N medium):

One of the results of Meselson-Stahl Experiment:

• Produced a single hybrid band (¹⁵N-¹⁴N) in the centrifuge.

• This showed that each DNA molecule had one old strand and one new strand.

- The conservative model was eliminated, since it predicted separate heavy and light bands.

Second Replication:

One of the results of Meselson-Stahl Experiment:

• Produced two bands — one light (¹⁴N-¹⁴N) and one hybrid (¹⁵N-¹⁴N).

• Conclusion: The dispersive model was eliminated, confirming that DNA replicates in a semiconservative manner

A large team of enzymes and other proteins

carries out DNA replication.

nucleotide pairs

It takes E. coli less than an hour to copy each of the 4.6 million _______ _____ in its single chromosome and divide to form two identical daughter cells.

6 billion

A human cell can copy its __________ nucleotide pairs and divide into daughter cells in only a few hours

Origins of replication

- DNA replication begins at these specific sites

Nucleotide Sequence

In bacteria, the origin is a specific ______ ______ recognized by replication enzymes.

origins

In eukaryotes, there may be hundreds or thousands of _____ per chromosome.

Replication Enzymes

-separate the DNA strands, forming a replication bubble.

- Replication proceeds in both directions from each origin until the entire molecule is copied.

Replication Forks

- a Y-shaped region where the parental DNA strands are being unwound.

- structures that form during DNA replication, where the double helix unwinds and separates into two strands.

bubbles elongate and eventually fuse together

As replication continues, bubbles _______ and eventually _____ together, completing the replication of the entire DNA molecule.

Helicase

Enzyme that untwists the DNA double helix at the replication forks.

Single-Strand Binding Proteins (SSBPs)

Enzyme that bind to and stabilize the single DNA strands to keep them apart.

Topoisomerase

Relieves strain ahead of the replication fork by breaking, swiveling, and rejoining DNA strands

Helicase, Single-Strand Binding Proteins, and Topoisomerase

What are the key enzymes involved in DNA replication forks?

Primase

An enzyme that joins RNA nucleotides to make a primer during DNA replication, using the parental DNA strand as a template.

parental DNA strands

Once the DNA strands are unwound, the ______ ____ strands become available to serve as templates for the synthesis of new complementary strands.

DNA Polymerases

- An enzyme that catalyzes the elongation of new DNA (for example, at a replication fork) by the addition of nucleotides to the 3′ end of an existing chain.

• The enzymes that synthesize DNA (DNA polymerases) cannot initiate the synthesis of a new strand from scratch.

• They can only add nucleotides to the end of an existing chain that is base-paired with the template strand.

What are the limitations of DNA Polymerase?

Primer

- The initial nucleotide chain that begins DNA synthesis that is a short stretch of RNA

- complementary to the parental DNA strand.

- synthesized by the enzyme primase.

typically 5-10 nucleotides long.

How long is a completed RNA primer?

3'

The new DNA strand begins at the ___ end of the RNA primer.

DNA Polymerase III and DNA Polymerase I

What are the two main DNA polymerases involved in replication in E. coli?

At least 11 different DNA polymerases have been identified, each with specialized functions.

How many different DNA polymerases have been identified in eukaryotes?

Most DNA Polymerases need/Requirements for DNA Synthesis

Needs:

▪ A primer (providing a starting 3′ end).

▪ A DNA template strand (to guide complementary base pairing).

~500 nucleotides per second.

What is the speed of replication in bacteria?

~50 nucleotides per second

What is the speed of replication in human cells?

Nucleoside Triphosphate

- a base + sugar + three phosphate groups

- Each new nucleotide added to a growing DNA strand comes from this

Pyrophosphate (P-Pi)

- Formed when a nucleotide is added to the growing end of a DNA strand, the last two phosphate groups are hydrolyzed

the energy that drives DNA polymerization.

The exergonic hydrolysis of pyrophosphate into two inorganic phosphates (2Pi) provides....?

Antiparallel

The two strands of the DNA double helix run in opposite directions,

• One strand runs 5′ → 3′, while the complementary strand runs 3′ → 5′.

This is called...?

3' end

- One of the ends of a DNA strand, has a free hydroxyl group (-OH) attached to the deoxyribose sugar.

5' end

- One of the ends of a DNA strand, has a free phosphate group (-PO₄) attached to the deoxyribose sugar

3'

DNA polymerases can add nucleotides only to the free ___ end of a growing strand.

new DNA strands elongate only in the 5′ → 3′ direction.

New DNA strands elongate only in the _____ direction.

new complementary strand

DNA polymerase III synthesizes the ____________ continuously along one template strand.

5′ → 3′

Elongation occurs in the mandatory _____ direction

Leading Strand

The DNA strand synthesized continuously along the template strand toward the replication fork in the mandatory 5' to 3' direction during DNA replication

continuously/ a single RNA primer

The leading strand is produced _______ and requires only a _____ to start synthesis.

Lagging Strand

• The other parental strand runs 5′ → 3′ into the replication fork

- Because DNA polymerase can only add nucleotides to the 3′ end, this strand must be synthesized away from the fork

- Synthesized discontinuously

Okazaki fragments.

The lagging strand is synthesized discontinuously as short DNA segments called _________.

Length of Okazaki fragments:

▪ ~1,000-2,000 nucleotides in E. coli (prokaryotes).

▪ ~100-200 nucleotides in eukaryotes.

What is the length of Okazaki fragments in E. coli (prokaryotes) and eukaryotes?

only one primer

The leading strand needs ____ primer for continuous synthesis

its own primer

Each Okazaki fragment on the lagging strand must be initiated by ________, since synthesis starts repeatedly as the fork opens.

DNA Polymerase I

- functions after DNA Polymerase III has synthesized most of the new DNA

- role is to replace the RNA nucleotides of the RNA primers with DNA nucleotides.

- It adds new DNA one nucleotide at a time to the 3′ end of the adjacent Okazaki fragment.

Its role is to replace the RNA nucleotides of the RNA primers with DNA nucleotides.

What is the role of DNA Polymerase I?

DNA Ligase

A linking enzyme essential for DNA replication; catalyzes the covalent bonding of the 3′ end of one DNA fragment (such as an Okazaki fragment) to the 5′ end of another DNA fragment (such as a growing DNA chain).

continuously/ single primer

The leading strand is synthesized _______ toward the replication fork from a _____ primer.

discontinuously/ new

The lagging strand is synthesized _________, away from the fork in short Okazaki fragments, each requiring a ____ primer

d) Mouse dies after being injected with a mixture of heat-killed S and living R cells.

Which of the following results from Griffith's experiment is an example of transformation?

a)Mouse dies after being injected with living S cells.

b)Mouse is healthy after being injected with living R cells.

c)Mouse is healthy after being injected with heat-killed S cells.

d) Mouse dies after being injected with a mixture of heat-killed S and living R cells.

a)22%

Suppose a double-stranded DNA molecule was shown to have 22% guanine bases. What would be the expected percentage of cytosine bases in that molecule?

a)22%

b)28%

c)50%

d)78%

e)not enough information

b)28%

Suppose a double-stranded DNA molecule was shown to have 22% guanine bases. What would be the expected percentage of adenine bases in that molecule?

a)22%

b)28%

c)50%

d)78%

not enough information

c)Yes, because the %A approximately equals the %T and the %G approximately equals the %C in both species.

Does the distribution of bases in sea urchin DNA and salmon DNA follow Chargaff's rules?

a)Yes, because the %A + %T is greater than the %G + %C in both species.

b)No, because %A + %T does not equal %G + %C in both species.

c)Yes, because the %A approximately equals the %T and the %G approximately equals the %C in both species.

d)No, because %A is higher than %T and %G is higher than %C in both species.

b)Franklin

Who conducted the X-ray diffraction studies that were key to the discovery of the structure of DNA?

a)Griffith

b)Franklin

c)Meselson and Stahl

a)The two strands are antiparallel and the 5' end on both strands contain a phosphate group

What can you conclude about the DNA backbones in a double-stranded DNA molecule?

a)The two strands are antiparallel and the 5' end on both strands contain a phosphate group

b)The two strands are parallel and the 5' ends on both strands contain a phosphate group

c)The two strands are antiparallel; the 5' end on one strand contains a phosphate group, whereas the 5' end on the other contains a hydroxyl group

d)The two strands are parallel; the 5' end on one strand contains a phosphate group, whereas the 5' end on the other contains a hydroxyl group

e)I, III, and IV

Which of these can be found in the DNA backbone:

I. Phosphate group

II. Ribose

III. Deoxyribose

IV. Phosphodiester bond

a)I, II, and IV

b)I, II, and III

c)I, III, IV, and V

d)II, IV, and IV

e)I, III, and IV

Phosphate-sugar

DNA's backbone consists of which of the following?

a)Purine-pyrimidine H-bonds

b)Phosphate only

c)Double helix

d) Phosphate-sugar

d. Thymine

The nitrogenous base Adenine can pair with _____.

a. Adenine

b. Cytosine

c. Guanine

d. Thymine

b. hydrogen bonds

Between the two strands of a DNA segment the nitrogen bases are held together by _____.

a. covalent bonds

b. hydrogen bonds

c. ionic bonds

d. metallic bonds

b)all hybrid DNA

In Meselson and Stahl's experiment proving semiconservative DNA replication, they started with bacteria grown in a heavy isotope of nitrogen and then switched them to a light isotope. They then observed the DNA density after one and two rounds of replication. What was the result after one round of replication?

a)equal amounts of light and hybrid DNA

b)all hybrid DNA

c)equal amounts of light, hybrid, and heavy DNA

d)twice as much light as hybrid DNA

e)three times as much light as hybrid DNA

a)equal amounts of light and hybrid DNA

In Meselson and Stahl's experiment proving semiconservative DNA replication, they started with bacteria grown in a heavy isotope of nitrogen and then switched them to a light isotope. They then observed the DNA density after one and two rounds of replication. What was the result after two rounds of replication?

a)equal amounts of light and hybrid DNA

b)all hybrid DNA

c)equal amounts of light, hybrid, and heavy DNA

d)twice as much light as hybrid DNA

e)three times as much light as hybrid DNA.

a)The leading strand is synthesized in the same direction as the movement of the replication fork, whereas the lagging strand is synthesized in the opposite direction.

How do the leading and the lagging strands differ?

a)The leading strand is synthesized in the same direction as the movement of the replication fork, whereas the lagging strand is synthesized in the opposite direction.

b)The leading strand is synthesized at twice the rate of the lagging strand.

c)The lagging strand is synthesized continuously, whereas the leading strand is synthesized in short fragments that are ultimately stitched together.

d)The leading strand is synthesized by adding nucleotides to the 3′ end of the growing strand, whereas the lagging strand is synthesized by adding nucleotides to the 5′ end.

c)both leading and lagging strands

Imagine a bacterial replication fork. Synthesis of which new strand(s) would be affected by mutations in the enzyme DNA polymerase III?

a)leading strand

b)lagging strand

c)both leading and lagging strands

d)neither leading nor lagging strand

c)both leading and lagging strands

Imagine a bacterial replication fork. Synthesis of which new strand(s) would be affected by mutations in the enzyme primase?

a)leading strand

b)lagging strand

c)both leading and lagging strands

d)neither leading nor lagging strand

c)both leading and lagging strands

Imagine a bacterial replication fork. Synthesis of which new strand(s) would be affected by mutations in the enzyme DNA ligase?

a)leading strand

b)lagging strand

c)both leading and lagging strands

d)neither leading nor lagging strand

a)5'- TTGCCAGGTCAGGTTCAATGC - 3'

Create the complimentary strand for the DNA strand below.

5'-AACGGTCCAGTCCAAGTTACG-3'

a)5'- TTGCCAGGTCAGGTTCAATGC - 3'

b)3'- TTGCCAGGTCAGGTTCAATGC - 5'

c)3'-AACGGTCCAGTCCAAGTTACG-5'

d)None of the answers are correct