AGRY 320 Exam 1

agry 320 flashcards

A field of study that focuses on traits that vary along a continuous scale and the transmission of these traits to offspring

Quantitative genetics

A field of study that focuses on DNA and gene action within and between cells

Molecular Genetics

A field of study that focuses on genetic changes over time within a group of individuals that interbreed

Population Genetics

What was the contribution of Griffith's experiment to genetics?

By studying diseases in mice, they concluded that non-disease causing bacteria can become disease causing when its DNA is transformed by DNA from disease-causing bacteria

What was the contribution of Rosalind Franklin to the discovery of the double-helix structure of DNA?

Her X-Ray image helped Watson and Crick to understand the structure better and guided them towards determining the correct physical and chemical structure

What was the contribution of the Hershey and Chase experiment to genetics?

By radioactively labeling DNA and protein molecules in phage and bacteria, then observing the results, they proved that DNA and not the protein carries the genetic information.

Which 3 elements make up DNA nucleotides?

Phosphate Group, sugar group, and nitrogenous base.

The following is a diagram of the central dogma of molecular genetics. Please fill in the correct terms for each letter.

A)

B)

C)

D)

E)

F)

A) Replication

B) DNA

C) Transcription

D) RNA

E) Translation

F) Protein

Why did Rosalind Franklin not share the stage with Crick and Watson for the Nobel Prize?

She was not alive at the time of the award.

Chargaff's experiment showed that no matter what the organism or species is, the _____ content always equals the _____ content and ______ content always equals ______ content

Adenine-Thymine-Guanine-Cytosine

The Guanine (G) content of an organism's DNA is 0.30. Following Chargraff's rule, what is the content of the other bases within this organism?

Adenine?

Cytosine?

Thymine?

Adenine: 0.20

Cytosine: 0.30

Thymine: 0.20

The Meselson-Stahl experiments proved that DNA replication follows a ________ replication model.

Semi-conservative

Fill in the following sentences according to molecular genetics principles learned.

Nucleotide A pairs with _____ via ____ _____ bonds

Nucleotide C pairs with _____ via _____ _____ bonds

Nucleotide A pairs with T via 2 hydrogen bonds

Nucleotide C pairs with G via 3 hydrogen bonds

What best describes eukaryotic and prokaryotic DNA?

Prokaryotic DNA is circular, while eukaryotic DNA is linear. Thus, eukaryotic DNA needs telomerase to protect against degradation at the end of the chromosomes (the telomeres).

In eukaryotic genes, what is the regulatory region?

promoter

Given that the DNA sequence for the antisense strand (aka template strand or non-coding strand) of a gen is 5'-ACTGGACCTGAAG-3', what is the mRNA sequence?

UGACCUGGACUUC

Transcription occurs on ______

both strands of DNA (3'-5' and 5'-3')

Consider the products of both DNA replication and transcription. What is true of this statement?

Replication produces double-stranded DNA (dsDNA) while transcription produces single stranded RNA (ssRNA)

In our experiment, we discover that the nucleotide sequence on a particular strand of DNA, read left to right, is AGACTCG. We'd like to determine the order of nucleotides on the complementary strand.

One lab partner says that to determine the complementary strand, we have to search through all the denatured DNA fragments in the test tube, then use a computer to give us the complementary strand sequence after running a complicated maximum-likelihood algorithm. A second lab partner tells us it is fairly easy to determine the complementary strand--no computers required.

Which lab partner do you think is right?

Whatever your method of determining the answer, please select below the correct order of nucleotides on the complementary strand, read left to right.

TCTGAGC

AGACTCG

Which of the following statements is/are TRUE?

(i.e. select ONLY the answer(s) that is/are TRUE.)

1)Post-transcriptional modification of the 3' ends of eukaryotic mRNA is known as polyadenylation.

2)The molecule Poly-A polymerase is responsible for addition of the Poly-A sequence to the end of an mRNA molecule.

3)RNA polymerase does not require primer to initiate the process of assembly of nucleotide triphosphates. This is in contrast to DNA replication, where primer is required at initiation.

4)Post-transcriptional modification of the 3' ends of eukaryotic mRNA occurs prior to splicing and inside the nucleus.

all of them

What are the three stages of transcription that are found in both eukaryotes and prokaryotes?

Initiation, Elongation, Termination

Some genes in __________ are polycistronic (multiple proteins are translated from one RNA transcript).

prokaryotes only

Untranslated regions (UTR) are located at (1)[] of the (2)[] of genes. They are (3)[] but not (4)[].

1) Both the 5' and 3' end

2) coding sequences

3) transcribed

4) translated

Take some time to review the conserved sequences found prior to the transcribed regions in eukaryotes and prokaryotes, and note the differences between the two.

With this in mind, please choose which of the following statements is completely correct.

In prokaryotes, these conserved sequences include a TTGACAT at -35 and TATAAT at -10 and a Shine-Delgarno sequence that recruits the ribosome to the mRNA. In eukaryotes, these conserved sequences include a TATA box between -25 to -30 and a CAAT box at -75 to -80.

DNA is an example of what level of hierarchical structure?

Tertiary

Which of the following are ingredients for PCR of a cancer gene?

Template/target DNA

Oligonucleotide primers

dNTP (dATP, dCTP, dGTP, dTTP)

Buffer (Mg++, etc.)

Thermostable DNA polymerase

all of them

In a PCR reaction, if we use a primer longer than 18-20 bp, it causes:

reduced annealing efficiency

In a PCR reaction, if we use a primer shorter than 18-20 bp, it causes:

lack of specificity

We start out with 10 DNA molecules. After 9 PCR cycles, how many DNA molecules do we have?

5120

n lecture on Friday, Dr. Anderson shared a publication of his research that gave the first report of a multiplex Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)-based assay, in context of detecting viruses in wheat.

Which of the following is the correct description of RT-PCR?

Starting with mRNA, we can create complementary DNA (cDNA).

To solve one of the problems of PCR, Kery Mullis used a DNA polymerase from a unique source. What was the problem, and how did this particular DNA polymerase solve it?

The DNA polymerase that was normally used to amplify segments of DNA was destroyed by the high temperatures at the beginning of each successive PCR cycle. As a result, it needed to be replaced prior to the beginning of each successive cycle.

So Dr. Mullis instead used Thermophobus aquaticus (Taq) DNA Polymerase, which was heat-resistant, as it was originally located in thermal vents in the ocean. Now he only needed to add DNA polymerase once at the beginning of the whole process.

We examine quantitative real time PCR experiment for the comparison of transcript levels of gene A in two tissue types: muscle and heart. We observe that PCR products of mRNA in muscle took 24 cycles to get to our targeted abundance level. To get to the same abundance level, it took 30 PCR cycles for the heart sample.

1. Before we started the amplification process, which sample had more copies of mRNA, muscle or heart?

muscle

We examine quantitative real time PCR experiment for the comparison of transcript levels of gene A in two tissue types: muscle and heart. We observe that PCR products of mRNA in muscle took 24 cycles to get to our targeted abundance level. To get to the same abundance level, it took 30 PCR cycles for the heart sample.

2. Can we use the results stated above to determine the exact copy number of the resulting transcripts in both samples?

no

We examine quantitative real time PCR experiment for the comparison of transcript levels of gene A in two tissue types: muscle and heart. We observe that PCR products of mRNA in muscle took 24 cycles to get to our targeted abundance level. To get to the same abundance level, it took 30 PCR cycles for the heart sample.

3. Can we use the results of this to experiment determine the relative copy number of transcripts between these two samples

yes

In RT-PCR, we use a particular enzyme.

What is that enzyme?

Reverse transcriptase.

In RT-PCR, a particular primer is used. What is that primer, and why is it used?

The primer is oligoT (TTTTT). It is used because it binds to the oligo A sequence of mRNA.

You are doing a PCR experiment. But you are really tired today as you just got a new puppy and it kept waking you up during the night.

You misread the amount of DNA polymerase enzyme called for in the protocol, and you mistakenly put in 2x the necessary amount. How does this affect your experiment?

After the amplification is complete, you discover that you have non-specific products.

indicate the correct PCR steps in the correct order

Denaturation

Annealing

Elongation

Repeat the previous steps 25-30 times

Bacterial cells have:

No organelles

Haploid DNA

Circular genome

Extra DNA (plasmids)

No nucleus

A bacteriophage is a _______ that infects _______ by _______ and then _______.

Virus - the bacterium - binding to the membrane - injecting the genetic materials

Bacteria can exchange genetic material by several different processes. What are these processes?

transformation, conjugation, and transduction

partial genome transfer by DNA uptake

Transformation

The transfer of DNA between bacterial cells by direct contact or a bridge-like connection between two cells

conjugation

Genes from one cell are carried to another cell within the genome of a virus. When the virus infects the second cell, the genes from the first cell are incorporated into the second cell's DNA.

Transduction

A sample of DNA molecules containing a gene of interest.

Donor DNA

Non-essential "accessory" chromosomes, such as plasmids or modified bacterial viruses.

Vectors

DNA molecules formed by fusion of donor DNA fragment and vectors.

Recombinant DNA

A process used to create copies of recombinant DNA.

DNA Cloning

Restriction enzymes work because they cut at specific palindromic sequences of DNA. Most (but not all) restriction enzymes create "sticky ends" after cutting the DNA.

What are these "sticky ends", and what purpose do they fulfill in gene characterization and cloning?

Sticky ends are unpaired bases at the end of a cut site, caused by a restriction enzyme that does not cut in the middle of the restriction sequence. This makes it easier for the resulting fragment to anneal to a sticky end of another fragment and re-establish a continuous DNA strand, thus enabling scientists to efficiently remove and re-insert portions of DNA.

5' -TAGACTGAATTCAAGTCA- 3'

3' -ATCTGACTTAAGTTCAGT- 5'

EcoR1

5' -ATACGCCCGGGTTCTAAA- 3'

3' -TATGCGGGCCCAAGATTT- 5'

SmaI

5' -CAGGATCGAAGCTTATGC- 3'

3' -GTCCTAGCTTCGAATACG- 5'

HindIII, AluI

5' -AATAGAATTCCGATCCGA- 3'

3' -TTATCTTAAGGCTAGGCT- 5'

EcoR1

Which restriction enzyme(s) is(are) 4-cutters (i.e. they recognize and cut at 4-bp sequences, instead of 6-bp sequences)?

AluI, HbaI

Which restriction enzyme(s) do not leave a "sticky end" after cutting the DNA?

AluI, SmaI

We want to cut the following DNA sequence into 3 fragments. Which restriction enzyme should we use?

(Use the digestion pattern table from the previous question.)

5'-GCGGGCCCCATTTATACCCTCCGCGCGCCGGACCGGGGTCCGCAAGGCGCGGCGGTGCACAAGCAGTTGACGACTGACCGCCGTGTATTCGTTATGGCACCAGGGAGTTCGGGCCGAGTCAATGGAGCTCGCAATACGGAGTTTACCGCGTCCTGCCCCAACCGACGGGCTGTGATCGACCACGAGCCAAGCCATTGCCTCTCGGGCACGCCGCTACAGCGATTACGAAAACCTTGCGGGGCATGGCTGCGGCCCGTTCAGCCACGTCCGAGGGCAGAAACCTGCCCCCATCCGTATGCTCGGCTATCTTCTACCCATCCCCGGGGGCTAGGCAGGTCGTGGGGTGCGGAGGAGGCTCTCGATCATCCCGTGGGACATCAACCTTCCCCTTGATAAAGCGCCCCGCTCGGGTGTGGCAGAGAGGACGCCTTCTGAGTTGTGCCATCCCTCGACCTCACCAAAGCTTGCTACCAATAATTAGGATCCCTGCCTCGCGACA-3'

AluI

A region of DNA to which RNA polymerase binds to initiate the transcription of a particular gene. Typically located upstream (towards the 5' region of the sense strand) of the gene.

promoter

A DNA-binding protein that regulates one or more genes by permitting and/or increasing the rate of transcription.

activator

A DNA-binding protein that regulates the expression of one or more genes by binding to the operator and blocking the movement of RNA polymerase, thus preventing transcription of the genes.

repressor

The binding sites of a repressor.

operator

3 basic steps for using recombinant DNA for protein expression

1) Construct recombinant DNA (rDNA) plasmid.

2) Introduce rDNA into bacteria.

3) Use bacteria to express human protein.

Please indicate which of the following elements of the regulatory system of the lac operon is a cis-acting element.

operator site

Please indicate which of the following elements of the regulatory system of the lac operon is a trans-acting element.

LacI repressor protein.

Regulation of gene expression in eukary

Transcription

Chromatin structure

Post-translation

Translation

Epigenetic

Post-transcription

As you learned in previous lectures, the physiologically regulated step in the bacterial lac operon is when the transcriptional regulator binds the DNA.

The eukaryotic system is different, and can be understood using the model of GAL. What is the physiologically regulated step in eukaryotic transcription, specifically the GAL model?

The actions of the transcriptional regulator, specifically the activation-domain.

What did we discover about the action of GAL80 and GAL3 on GAL gene expression?

GAL80 inhibits expression of the GAL gene, and GAL3 promotes the expression of the GAL gene.

The tails on the histones that make up the chromatin can be altered to help activate or deactivate genes. Please indicate below specifically which histone tail modification leads to activation or deactivation of genes.

Activated genes.

Histone acetylation.

The tails on the histones that make up the chromatin can be altered to help activate or deactivate genes. Please indicate below specifically which histone tail modification leads to activation or deactivation of genes.

Deactivated genes.

Histone deacetylation.

RNA interference (RNAi) is a natural process by which cells suppress the activity of specific genes by targeting and degrading mRNA. One way RNAi has been harnessed by agricultural scientists is to protect plants from pest attacks on the roots of corn plants.

Choose the answer below that correctly describes the steps in the RNAi process that eventually result in degradation of the target mRNA.

1. The protein Dicer recognizes double-stranded RNA (dsRNA)

2. Dicer cuts up the dsRNA into small segments (still double-stranded).

3. RNA-Induced silencing complex (RISC) separates the two strands of the small segments.

4. RISC carries one strand of the small segment.

5. RISC uses that one strand to bind a complementary mRNA transcript.

6. Once the anti-sense strand is bound, RISC degrades the target mRNA.

Original sequence: AATGCCAATT

Mutated sequence: AACGCCAATT

Transition substitution

Original sequence: AATGCCAATT

Mutated sequence: AATGCCCATT

Transversion substitution

Original sequence: AATGCCAATT

Mutated sequence: AATGCCCAATT

Insertion

Original sequence: AATGCCAATT

Mutated sequence: AATGCCATT

Deletion

Over the years, scientists have come to understand that molecular DNA can be altered in such a way that the actual genetic code (order of A, T, G, and C) does not change, yet there is a different physical outcome based on some type of cellular or molecular "memory".

A specific example comes from the Dutch Hunger Winter. In the winter of 1944-45, the Germans blocked food supply routes into the Netherlands, inducing a famine. Mothers who were pregnant at the time were especially vulnerable. The children who were born during this time, it turns out, have been influenced by this famine for the rest of their lives. They had documented higher rates of obesity, diabetes, and schizophrenia. This group also had a 10 percent increase in mortality compared to others born before or after them.

Their actual genetic code didn't change. But obviously the cells had some "memory" of the famine conditions experienced in-utero. So scientists did a study to determine the molecular imprint. Their conclusion was:

"Our data are consistent with the hypothesis that epigenetic mechanisms mediate the influence of transient adverse environmental factors in early life on long-term metabolic health."

What were these specific epigenetic mechanism(s)?

DNAm

In ______ genetics approach we identify the responsible ______ through evaluation of phenotypes in a population of variants.

Forward - gene

Forward - trait

Reverse - gene

Mutant variant screening is considered a ______ genetics approach, while ______ is considered a _______ genetics approach.

Forward - knock-out gene silencing - reverse

Google has offered a $1 million prize to the lab who creates the first sequence map of a dinosaur genome. We think we can do it, as we happened to get our hands on a preserved piece of dinosaur skin and were able to extract some DNA.

But our lab computer guy accidentally applied his randomization algorithm to our protocol. So now the steps are all out of order. Oops.

Can you put the following steps back in the correct order?, so we can get working on creating the sequence map?

1.

Cut many genome copies into random fragments

2.

Make a library of cloned fragments.

3.

Sequence each clone.

4.

Overlap sequence reads

How large (in bp) is the entire human ge

3 billion bp

In the context of DNA sequencing, what is a reference genome?

A representative example of a species' set of genes, to which segment reads are aligned by bioinformatics software.

A sample of normal double-stranded DNA was found to have an adenine content of 24%.

What is the expected proportion of cytosine?

26%

In what cellular compartment are introns removed from pre-mRNA to make mature mRNA?

nucleus

The following data were obtained from three organisms: an RNA virus, a DNA virus, and a

mammal. Which is likely the sample from the RNA virus?

Sample (organism a) (organism b) (organism c)

Adenine 27.0 23.0 29.0

Cytosine 24.0 27.0 21.0

Guanine 23.0 27.0 21.0

Thymine 26.0 23.0 0.0

Uracil 0.0 0.0 29.0

organism c

The -10 and the -35 boxes found in bacterial gene promoters function to:

orient RNA polymerase at a gene's transcription start site.

The complexity of lagging strand DNA replication is necessary because:

as polymerization occurs only in the 5' to 3' direction, the lagging strand must be

synthesized in consecutive small fragments.

Which of the following is/are TRUE for RNA compared to DNA?

A. RNA has ribose sugar in its nucleotides, rather than the deoxyribose found in

DNA.

B. RNA is usually single-stranded and can make more complex three-dimensional molecular

shapes than double-stranded DNA.

C. RNA contains the bases A, G, C, and U, whereas DNA contains the bases A, G, C, and T.

D. RNA can catalyse biological reactions, but DNA cannot.

E. All of the answer options are correct.

All of the answers are correct

If the DNA sequence below were transcribed and translated from left to right (bottom strand is

the template strand), what would the amino acid sequence be?

5` ATGTTGCAAAAG 3`

3` TACAACGTTTTC 5`

Met-Leu-Gln-Lys

The spliceosome functions to:

remove noncoding introns from transcribed RNAs.

A key characteristic of bacterial RNAs that is not observed with eukaryotic RNAs is that:

transcription can occur in the same cellular region as translation.

. The "wobble" base is less important than the other two nucleotides in a codon/anticodon

binding, and is found:

at the 5' end of the tRNA anticodon.

HFr refers to

A cell in which the F plasmid has been integrated into the cell chromosome

Recombinant DNA techniques typically require the action of

Restriction enzymes and DNA ligase

In the Sanger method of DNA sequencing, what causes the termination of chain

elongation?

The incorporation of a dideoxynucleotide

What is an auxotroph?

. A mutant strain that lacks the ability to synthesize a molecule that is essential for

viability

Suppose that a bacterium with the genotype met+ his- lys+ arg- picked up a piece of

DNA from an Hfr strain bearing the genotype met+ his+ lys- arg+. The following

diagram shows the position of the recombination events that occurred shortly after the

bacterium acquired the additional genes. Which of the possible answers listed below

would be the genotype of the bacteria following these recombination events?

met+ hit+ lys-arg-

In general, the role of an antibiotic resistance gene in a cloning vector or plasmid is to:

allow for differentiation between competent bacterial cells that have taken up a vector

(recombinant or non-recombinant) and those that have not taken up any vector

The genome of Arabidopsis contains over 25 000 genes. It is possible to use PCR to

make many copies of just one very small region of this genome (for example, 500 bp).

What component of a PCR reaction gives it specificity?

oligonucleotide primers

Plasmid vector, pUC18, allows for simple screening for recombinant plasmids.

Insertion into pUC18 is detected by inactivation of the β-galactosidase function of lacZ'.

What kind of colonies growing on the medium with artificial galactose substrate X-Gal

have the DNA insertion?

White colonies

A linear DNA molecule has 3 target sites for restriction enzyme EcoRI. How many

fragments will be produced after complete digestion?

4

In the study of genetics, a "library" denotes:

a collection of DNA fragments isolated from a particular group of cells (or tissue)

representing the genetic content of those cells

The lac repressor protein controls expression of the lac operon by binding to the:

Lac operator site to repress expression