Module 2 Self Evaluations

Two "naked" (without histones or other proteins) double-stranded fragments of DNA are exactly the same length. At 89°C, fragment A has completely denatured, which means that the two strands have separated. At that temperature, fragment B is still double-stranded. How might these fragments differ, to result in different denaturation temperatures?

What are the four nucleotides that make up RNA?  Give full names, not abbreviations.

Uracil, Guanine, Cytosine, Adenine

What are the three classes of “functional” RNAs (not including mRNA)?  Briefly describe the role of each class of functional RNA.

tRNA -- brings the correct amino acid to the mRNA during translation.

rRNA -- major component of ribosomes.

snRNA -- helps process RNA transcripts (especially, helps remove introns).

List the following events in the pre-RNA processing of a one intron–two exon gene in correct sequence order:

•	Attachment of snRNP U1 to the 5' splice site
•	Transesterification reaction at the branch point adenine
•	Transcription of the DNA template into the pre-mRNA molecule
•	Recognition and binding the 3' AAUAAA sequence by specific protein factors
•	Cleavage at the poly(A) site
•	Addition of the 5' cap
•	Export to the cytoplasm
•	Addition of the poly(A) tail
•	Release of lariat structure
•	Splicing together of exons

Transcription of the DNA template into the pre-mRNA molecule

Addition of the 5' cap

Recognition and binding the 3' AAUAAA sequence by specific protein factors 

Cleavage at the poly(A) site

Addition of the poly(A) tail

Attachment of snRNP U1 to the 5' splice site

Transesterification reaction at the branch point adenine

Release of lariat structure

Splicing together of exons

Export to the cytoplasm

Below is a list of several phenomena relating to protein structure. Clearly describe each phenomenon, the conditions under which each occurs, and the probable influence each has on protein structure.

- Hydrophobic interactions

- Hydrogen bonds

- Disulfide bridges

- Hydrophobic interactions: Hydrophobic portions of the protein will interact with each other in the interior of the structure while forming a hydrophilic exterior.

- Hydrogen bonds: H-bonds form between C and G and A and T/U during transcription. When folding occurs into secondary structures, H-bonds form between B pleated sheets and within a helix

- Disulfide bridges: Disulfide bonds form between cysteine side chains of proteins and are relatively strong bonds.

The concept that genetic information passes from DNA to RNA to protein is called

central dogma

In eukaryotes, which RNA polymerase transcribes the genes that encode proteins?

Referring to the genetic code, what is meant by "wobble"?

What is the name of the precursor molecule used in nucleic acid synthesis (do not give an abbreviation)?

nucleoside triphosphate

Considering the types of side chains on amino acids and their relationship to protein structure, where are the amino acids with hydrophobic side chains most likely to be located?

Why does DNA polymerase III exist as a dimer?

An organism has a T content of 20%. What is the percentage for C?

30%

In the Meselson-Stahl experiment, what hypothetical form of DNA replication results in the same DNA density distribution as the semiconservative method after the first cell division, but was not supported upon the second cell division?

Antisense oligonucleotides are relatively short stretches of nucleotides (usually about 20 nucleotides long) that are likely to bind with sense RNAs in a given cell. Of what importance might such a material have in human health?

When codons that code for the same amino acid differ in their ________, a single tRNA might bind both of them through wobble base pairing.

3’ base

Eukaryotic chromosomes contain two general domains that relate to the degree of condensation. These two regions are

called heterochromatin and euchromatin.

Which of the following statements best describes the messenger RNA?

mRNA is the only type of RNA that carries DNA's protein building instructions

Which of the following are among the major components of prokaryotic ribosomes?

16S rRNA, 5S rRNA, and 23S rRNA

Which of the following statements is not true concerning RNA and DNA?

RNA is more stable than DNA

Side groups of amino acids are typically grouped under which of the following?

polar, nonpolar

What would Avery, Macleod, and McCarty have concluded if their results had been that only RNAse treatment of the heat-killed bacteria prevented transformation of genetic virulence?

that RNA was the genetic material

Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes

excision of introns

The long-term storage of genetic information in a cell occurs in the:

DNA

In prokaryotes, translation of an mRNA is coupled to

transcription

Which of these sequences, if paired with its complementary strand, would be a palindrome?

5' CCCGGG 3'

In each round of the elongation cycle of protein synthesis, a new _______ binds to the codon in the _______ site, then the peptide is transferred from the tRNA in the _______ site to the new aminoacyl-tRNA, and finally the entire _______ moves along the mRNA in a 5' to 3' direction.

aminoacyl-tRNA; A; P; ribosome

Regarding the structure of DNA, the covalently arranged combination of a deoxyribose and a nitrogenous base would be called a

nucleoside

Select three posttranscriptional modifications often seen in the maturation of mRNA in eukaryotes.

5'-capping, 3'-poly(A) tail addition, splicing

In an analysis of the nucleotide composition of double-stranded DNA to see which bases are equivalent in concentration, which of the following would be true?

A + C = G + T

In one strand of DNA, the nucleotide sequence is 5'-ATGC-3'. The complementary sequence in the other strand must be:

3'-TACG-5'

The ribosome is the primary site of:

protein synthesis

The nitrogenous base that is found in RNA but not in DNA is

uracil

The relationship between codon and anticodon can be characterized as involving ________ between complementary bases (usually) in typical ________ fashion.

hydrogen bonds, antiparallel

The packaging of DNA into a confined space is what level of DNA structure?

tertiary

Briefly define the term "autoradiography".  Identify and describe a classic experiment that used autoradiography to determine the replicative nature of DNA in eukaryotes.

Autoradiography is a technique that allows an isotope to be detected within a cell: The Taylor, Woods, and Hughes (1957) experiment used 3H-thymidine.

Here is a list of eukaryotic RNA polymerases. Match them with what they transcribe.

RNA Pol I; RNA Pol II; RNA Pol III

a. mRNA    b. tRNA    c. rRNA    d. snRNA

RNA Pol I: c
RNA Pol II: a, d
RNA Pol III: b, c, d

What is unusual about the amino acid composition of histones? How is the function of histones related to the amino acid composition? Of which histones are nucleosomes composed? 

Histones contain large amounts of positively charged amino acids such as lysine and arginine. Thus, they can bind electrostatically to the negatively charged phosphate groups of nucleotides. Nucleosomes are composed of all histones except H1.

RNA polymerase must bind to a region of DNA called a(n) ____________ in order to begin transcription.

promoter

A procedure that is often used to separate molecules by using their molecular charges is called ________

electrophoresis

Name the pyrimidines and the purines in DNA.

Pyrimidines: Cytosine, Thymine

Purines: Guanine, Adenine

A(n) ________ is a section of an RNA that gets spliced out.

intron

3' TACCGTGCGTGACATTAAGCC 5'
What would be the sequence of a single-stranded DNA produced by using the DNA sequence shown as a template?

ATGGCACGCACTGTAATTCGG

What is meant by the term heterogeneous nuclear RNA (hnRNA)?

The bonds that connect nucleotides in the backbone of a DNA strand are called _________bonds.

phosphodiester

_____________ is seen primarily among prokaryotes where one mRNA carries coding information and internal punctuation for the translation of more than one protein.

polycistronic mRNA

Match the term with the best letter choice: DNA ligase

i. phosphodiester bonds at DNA nicks

This term describes the sequence of nucleotides that direct the formation of a new nucleic acid strand.

When examining the genetic code, it is apparent that

there can be more than one codon for a particular amino acid.

An intron is a section of

RNA that is removed during RNA processing.

What secondary structures are formed when single-stranded DNA or RNA is inverted and complementary?

hairpin

The term peptidyltransferase relates to

peptide bond formation during protein synthesis.

The relationship between a gene and a messenger RNA is that

mRNAs are made from genes.

The secondary structure of a protein includes the following elements:

α-helix and β-pleated sheet.

In the classic experiment conducted by Hershey and Chase, why was the pellet radioactive in the centrifuge tube that contained bacteria with viruses, which had been grown on medium containing ³²P?

The bacteria were in the pellet, and many contained the radioactive viral DNA. 

Which cluster of terms accurately reflects the nature of DNA replication in prokaryotes?

fixed point of initiation, bidirectional, semiconservative

In what cellular compartment are introns removed from pre-mRNA to make mature mRNA? 

nucleus

In E. coli, which terms accurately reflect the nature of replication of the chromosome?

bidirectional and fixed point of initiation

If a DNA molecule is 30% cytosine (C), what is the percentage of guanine (G)?

30%

DNA consists of repeating units of nucleotides. Which is NOT a component of a nucleotide?

a ribose sugar

What chemical group is found at the 5' end of a DNA molecule?

phosphate group

What is the function of the TATA binding protein?

Allows eukaryotic RNA polymerase II to bind to the promoter of genes

In 1964, Nirenberg and Leder used the triplet binding assay to determine specific codon assignments. A complex of which of the following components was trapped in the nitrocellulose filter?

charged tRNA, RNA triplet, and ribosome

When considering the initiation of transcription, one often finds consensus sequences located in the region of the DNA where RNA polymerase(s) bind. Which are common consensus sequences?

CAAT, TATA

Briefly describe what is meant by the term exon shuffling.

In the 1970s, Walter Gilbert suggested that the functional regions of genes in eukaryotes consist of collections of exons originally present in ancestral genes that are brought together through various recombination events over time.

continuous synthesis

h. leading strand

The finding that virtually all organisms use the same genetic code provides the basis for declaring that the code is universal. Name one exception to such universality.

This molecule is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil.

RNA

There is some indication that the code is in some way ordered; a certain pattern exists. Name an observation that supports this view.

Chromosomal regions that represent evolutionary vestiges of duplicated copies of genes that have underdone sufficient mutations to render them untranscribable are called ________.

pseudogenes

Until about 1970, mitotic chromosomes viewed under the microscope could be distinguished only by their size, positions of centromeres, and "satellites" in some cases. However, various staining techniques have allowed a different view of chromosomes because they allow the visualization of ________.

This new strand of DNA has its 3' end oriented in the same direction as the replication fork travels.

leading strand

Telomerase is composed of what two types of macromolecules?  What is the name for such a combination?

protein and RNA, ribonucleoprotein

Before DNA was known to be the genetic material, scientists knew that genetic material must do or be all of the following, EXCEPT that

genetic material must be composed of many different units to account for the variability seen in nature.

Which of the following is not a component within a single nucleotide of a nucleic acid?

polymerase

The “RNA World” theory suggests that:

RNA was the genetic material in the first living cells.

Heterochromatin is characterized by all of the following, EXCEPT that it

contains genes that require high levels of transcription.

Which of the following best describes the addition of nucleotides to a growing DNA chain?

A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate.

Considering the structure of double-stranded DNA, what kinds of bonds hold one complementary strand to the other?

hydrogen

The one-gene, one-enzyme hypothesis emerged from work on which two organisms?

Neurospora and Drosophila

Three posttranscriptional modifications often seen in the maturation of mRNA in eukaryotes occur in which cellular organelle?

nucleus

Reverse transcriptase (from a retrovirus like HIV) generates

DNA from RNA

Telomeres________________the end of chromosomes

stabilize

The β chain of adult hemoglobin is composed of 146 amino acids of a known sequence. In comparing the normal β chain with the β chain in sickle cell hemoglobin, what alteration is one likely to find?

valine instead of glutamic acid in the sixth position

In trying to determine whether DNA or protein is the genetic material, Hershey and Chase made use of which of the following facts?

DNA contains phosphorus, but protein does not

Which of the sequences could form a hairpin?