BIOL 4003 Exam 3

A mutation changes a valine codon to a histidine codon. This is a

a. silent mutation

b. missense mutation

c. frameshift mutation

d. nonsense mutation

b

A key event that promotes trinucleotide repeat expansion is

a. chromosome breakage

b. the formation of a hairpin

c. the presence of an AT-rich region

d. the presence of a lesion in the DNA

b

According to the Holliday model for homologous recombination, a heteroduplex is formed due to

a. the initial breakage of the DNA at a single location in two different DNA strands

b. the formation of a D loop

c. the migration of a Holliday junction

d. the resolution of the Holliday junction into two separate DNA molecules

c

Following homologous recombination, gene conversion may occur via

a. mismatch DNA repair or nucleotide excision repair

b. mismatch DNA repair or gap repair synthesis

c. nucleotide excision repair or non homologous end joining

d. nucleotide excision repair or gap repair synthesis

b

Which of the following proteins is/are needed during some types of retrotransposition, such as they movements of Ty in yeast?

a. transposase

b. reverse transcriptase

c. integrase

d. b and c

d

Which of the following proteins is never needed during retrotransposition?

a. transposase

b. reverse transcriptase

c. integrase

d. all of the above may be needed

a

A primer used in dideoxy DNA sequencing is 20 nucleotides long and has the following sequence: 5'GGATCCATGACTAGTCCGAC3'. A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to the dideoxy DNA sequencing method. Below is the DNA sequence from a region in the vector. The primer annealing site is shown in bold and underlined. 3'CCTAGGTACTGATCAGGCTG5'. What would be the sizes of the bands in the lane in which dideoxyT had been added?

a. 1, 2, 5

b. 21, 22, 25

c. 3, 7

d. 23, 27

b

Why is taq polymerase used in PCR as opposed to DNA polymerase from another source such as Ecoli?

a. synthesizes DNA faster

b. heat resistant

c. less likely to make errors

d. all of the above

b

Which of the following describes how Dolly was created?

a. a mammary cell was made totipotent by treating it with hormones

b. a mammary cell had its nucleus removed and the nucleus from a oocyte was inserted into it

c. a mammary cell was fused with an egg cell that had its nucleus removed

d. a sperm and egg cell were fused with a mammary cell that had its nucleus removed

c

Glofish are zebrafish that contain a gene from either a coral or jellyfish. This is an example of

a. gene replacement

b. gene addition

c. gene editing

d. both a and b

b

A DNA microarray is used to

a. determine the sequence of a gene

b. examine gene expression at the level of the whole genome

c. clone genes into vectors following restriction digestion

d. determine if DNA replication has occured

b

Which of the following statements regarding a multiple sequence alignment is false?

a. it aligns sequences that are homologous to each other

b. it can identify sites that are conserved and therefore may be functionally important

c. it is used to determine the relative transcription levels of different genes

d. all of the above are true

c

The alpha-globing gene in humans and the beta-globing genes in humans can be described as

a. members of a gene family

b. orthologs

c. paralogs

d. a and c

d

Which of the following would not be consistent with the idea that a human disease has a genetic component?

a. the disease is similar to one that occurs in other mammals

b. the disease has a particular age of onset

c. a correlation is found between the presence of a mutation in a particular gene and the occurrence of the disease

d. all of the above are consistent

d

Below is a pedigree involving a human disease that is inherited in a simple mendelian matter. Which of the following patterns are not consistent with this pedigree?

a. autosomal dominant

b. autosomal recessive

c. x-linked recessive

d. both b and c

d

What is the most common explanation for a recessive disorder?

a. loss of function mutation

b. gain of function mutation

c. dominant negative mutation

d. haploinsufficiency

a

Which of the following could convert a protooncogene into an oncogene?

a. gene amplification

b. missense mutation

c. translocation

d. all of the above

d

Which of the following is a common way to eliminate the function of a tumor suppressor gene?

a. mutation within the gene itself

b. chromosome loss

c. DNA methylation

d. all of the above

d

The BRCA-1 gene in humans is a tumor suppressor gene that can play a role in certain types of inherited breast cancers. Which of the following statements regarding this gene is false?

a. a pre-disposition to develop breast cancer due to BRCA-1 mutation displays a dominant inheritance pattern in a pedigree

b. the mutation in BRCA-1 that promotes cancer is a loss of function mutation

c. the severity of cancer increases in successive generations, a phenomenon called anticipation

d. at the cellular level, the BRCA-1 mutation is recessive

c

In a population in HWEQ, the percentage of individuals exhibiting a recessive disorder is 4%. What is the frequency of heterozygotes?

a. .96

b. .48

c. .32

d. .16

c

Below are the steps of the cloning process. Which of them is incorrect?

a. 1. cut the vector with a restriction enzyme and cut the chromosomal DNA with a different restriction enzyme

b. 2. add DNA ligase

c. 3. transform the DNA into the bacteria

d. 4. plate the bacteria on growth media containing an antibiotic such as ampicillin and also containing xGAL and IPTG

e. all of the above are correct

a

The restriction enzyme BamHil recognizes the sequence:

5 G/GATCC 3 // 3 CCTAG/G 5. It cuts between the GG as shown. Following the digestion of chromosomal DNA and vector DNA with BamHi, let's supposed that one fragment of chromosomal DNA gets inserted into a vector. No DNA ligase has been added. If both of the sticky ends of the chromosomal DNA fragment are binding to the sticky ends of the vector, what is holding the pieces together?

a. 10

b. 13

c. 16

d. 20

e. 26

f. 32

d

In a cloning experiment, the restriction enzyme that you use cuts the vector in the middle of the lacZ gene. To create a recombinant vector, a fragment of chromosomal DNA is inserted into the restriction site. In addition to ampicillin, the growth media contains xGal and IPTG. Which cells would you expect to form white colonies?

a. cells that contain a recircularized vector

b. only cells that contain a vector with the gene of interest

c. only cells that contain a vector with a fragment of DNA that is not the gene of interest

d. both cells that contain a vector with the gene of interest and cells that contain a vector with a fragment of DNA that is not the gene of interest

e. both cells that contain a recircularized vector and cells that contain a vector with a fragment of DNA that is not the gene of interest

d

When a fragment of chromosomal DNA is inserted into a vector, how many covalent bonds are made via DNA ligase?

a. 1

b. 2

c. 4

d. 8

e. 16

c

The B allele is dominant to the b allele. When the percentage of individuals with the BB or Bb genotype is low, the fitness values of BB or Bb are higher than bb. When the percentage of bb is low, fitness of bb is highest.

a. directional selection

b. disruptive selection

c. negative frequency dependent selection

d. heterozygote advantage

e. stabilizing selection

c

The bb genotype has an extreme phenotype and has an intermediate fitness, and the BB genotype as the lowest fitness.

a. directional

b. disruptive

c. negative frequency dependent

d. heterozygote advantage

e. stabilizing

a

The Bb has the highest fitness.

a. directional

b. disruptive

c. neg freq dep

d. hetero adv

e. stabilizing

d

The B and b alleles exhibit incomplete dominance and the species occupies a heterogenous environment. The BB genotype has the highest fitness in colder regions, where the bb has the higher fitness in warmer regions.

a. directional

b. diversifying/disruptive

c. neg freq dep

d. hetero

e. stabilizing

b

During PCR, what is the order of events in a single cycle?

a. anneal, denature, synthesize

b. anneal, synthesize, denature

c. denature, synthesize, anneal

d. denature, anneal, synthesize

d

As described in your textbook, one way to determine if a segment of chromosomal DNA has been inserted into a vector is to put XGal in the growth media. Following overnight growth,

a. blue colonies contain a vector with an inserted fragment of chromosomal DNA; the lacZ gene has been inactivated

b. white colonies contain a vector with an inserted fragment of chromosomal DNA; the lacZ gene has been inactivated

c. blue colonies contain a vector with an inserted fragment of chromosomal DNA; the lacZ gene has not been inactivated

d. white colonies contain a vector with an inserted fragment of chromosomal DNA; the lacZ gene has not been inactivated

b

Human insulin that is used to treat diabetic patients is commonly made in bacteria. When insulin is made in bacteria, why are the A and B chains linked to b-galactosidase?

a. to prevent misfolding

b. to prevent bacterial enzymes from degrading the A and B chains

c. to prevent the A and B chains from inhibiting the growth of E coli

d. all of the above

b

When a gene knockin is made in mice, the gene of interest ______. This is an example of _______.

a. is swapped with an endogenous gene, gene replacement

b. is swapped with an endogenous gene, gene addition

c. is inserted into a noncritical site in the genome, gene replacement

d. is inserted into a noncritical site in the genome, gene addition

d

The restriction enzymes below cut the DNA in the following manner. The slashes indicate where cutting occurs. Which of the enzymes would generate sticky ends that would be the most stable when they bind to complementary sticky ends?

a. BamHI

b. HaeII

c. EcoRI

d. PstI

b

Which of the following is a key feature of stem cells?

a. they have the ability to divide

b. they have the ability to differentiate

c. they are always pluripotent

d. a and b

d

Researchers conducted northern blotting on a sample of cells from a mouse kidney, brain, and liver using a probe that is complementary to a gene that encodes a glucose transporter. The following results were obtained. If we assume that equal amounts of total cellular RNA was loaded into each lane, which of the following statements is true?

a. brain cells express this gene at the highest level

b. the pre-mRNA is alternatively sliced

c. the gene in the kidney cells has suffered a deletion

d. all false

b

Which of the following statements concerning CHIP is true?

a. proteins are cross linked to DNA after the DNA has been extracted from cells

b. the technique is used to determine the locations of specific mutations in a whole genome

c. proteins that are not recognized by an antibody precipitate and end up in the pellet

d. this technique is used to determine where in the genome a particular protein binds

d

What is the purpose of the BLAST program?

a. to determine if a DNA sequence contains one or more genes

b. to identify genes in a database that are homologous to the query sequence

c. to determine if a particular gene has incurred a mutation

d. to determine if a segment of DNA is recognized by a particular protein

b

Which of the following would not be consistent with the idea that a human disease has a genetic component?

a. it has a particular age of onset

b. it is more likely to occur in relatives living apart than in relatives living together

c. a correlation is found between the presence of a mutation in a particular gene and the occurrence of the disease

d. all of the above are consistent

b

Which of the following would not convert a protooncogene into an oncogene?

a. gene amplification

b. missense mutation

c. promoter deletion

d. translocation

c

A dominant mutation in D can cause disease symptoms. Gene D encodes an enzyme. The activity in homozygous normal individuals is 100%. The activity in heterozygotes is 25%. This observation is consistent with

a. gain of function

b. dominant negative

c. haploinsufficiency

d. b or c

b

Which of the following methods is not used to study the level of RNA synthesis in a sample of cells at the genomic level?

a. DNA microarrary

b. RNA seq

c. CHIP

d. all of the above are used to study transcription at the genomic level

c

Which of the following is a common way to eliminate the function of a tumor suppressor gene?

a. mutation within the gene itself

b. chromosome loss

c. epigenetic change

d. all of the above

d

How would a mutation that increases the rate of GTP hydrolysis by the Ras protein affect the EGF signaling pathway and how would it affect cell growth?

a. the signaling pathway would stay turned on and cell growth would be stimulated

b. the signaling pathway would stay turned on and cell growth would be inhibited

c. the signaling pathway would be turned off faster and cell growth would be stimulated

d. the signaling pathway would be turned off faster and cell growth would be inhibited

d

A gene pool is

a. all of the genes in a single individual

b. all of the genes in the gamete of an individual

c. all of the genes in a population of individuals

d. the random mixing of genes during sexual reproduction

c

What is Darwinian fitness?

a. the relative allele frequencies in a population

b. the relative reproductive success of a genotype

c. the level of heterozygosity of the gene pool

d. the rate of population growth

b

Genetic drift is affected by

a. population size

b. random sampling error

c. fitness

d. both a and b

d

In natural populations, most genes are

a. polymorphic

b. monomorphic

c. recessive

d. both a and c

a

What is the inbreeding coefficient for VI-1?

0.0039

0.0039

In negative frequency dependent selection, the rarest phenotype has the highest fitness. The scenario is likely to result in

a. directional

b. stabilizing

c. disruptive

d. balancing

d

Which of the following is not expected to occur as a result of bidirectional migration?

a. it tends to reduce allele frequency differences between two populations

b. it can enhance genetic diversity within a population because new mutations in one population can be introduced to neighboring population

c. it tends to increase the rate of directional selection

d. all of the above are expected to occur as a result of bidirectional migration

c

A population occupies a heterogenous environment in which the fitness of some genotypes is higher in one environment while the fitness of other individuals is higher in another environment. This scenario is likely to result in

a. directional

b. stabilizing

c. disruptive

d. heterozygote advantage

c

Which of the following would not promote polymorphism?

a. directional selection

b. diversifying

c. heterozygote advantage

d. negative frequency dependent selection

a

Which of the following traits do/does not exhibit a continuum?

a. height in humans

b. red and white eyes in drosophila

c. fruit weight in tomatoes

d. all of the above exhibit a continuum

b

The variance is

a. a measure of the variation around the mean

b. computed as a square of the deviation

c. higher when there is less phenotypic variation

d. both a and b

d

In a strain of tomatoes, the variance for fruit weight is 441g, and the mean weight is 412g. How heavy would a tomato have to be to rank in the top 2.3%?

a. equal or greater than 433

b. equal or greater than 454

c. equal or greater than 475

d. equal or greater than 824

b

Researchers determined the correlation coefficient for egg weight between mothers and their daughters; it was found to be 0.49 with an N value of 38. Based solely on observation, which of the following statements is/are false?

a. due to the statistical significance, you may conclude a cause-and-effect relationship

b. there is a positive correlation between genetic relatedness and egg weight

c. if the data had been collected on a much smaller population with N=5, an r value of 0.52 would not have been ss

d. all of the above are true

a

In a population of humans, the correlation between height for fathers and their adult sons is 0.24. What is the narrow sense heritability for weight in this population?

a. 0.12

b. 0.34

c. 0.48

d. 0.96

c

Which of the following is not an important feature of QTL mapping?

a. a researcher must have two different parental strains that differ with regard to molecular markers

b. a researcher must have two different parental strains that differ with regard to a quantitative trait

c. the parental strains must be heterozygous for most or all of their genes

d. all of the above are important

c

If two or more different genotypes are not affected by environmental variation in the same way, this outcome is due to

a. genotype-environment association

b. genotype-environment interaction

c. additive effects of alleles

d. both a and b

b

Which of the following factors is/are not considered when calculating narrow sense heritability?

a. Va, additive variance

b. Vd, dominant/recessive variance

c. Vi, epistatic interaction

d. b and c

d

the mean weight of cows in a population is 520kg. animals with a mean weight of 540kg are used as parents and produce offspring that have a mean weight of 535kg. What is the narrow sense heritability for body weight in this population of cows?

a. 0.25

b. 0.5

c. 0.75

d. 1.0

c

With regard to heterosis, which of the following statements is/are consistent with only the over dominance hypothesis?

a. strains that have been highly inbred have become monomorphic for one or more recessive alleles that are somewhat detrimental to the organism

b. heterosis occurs because highly inbred strains are monomorphic for many genes, whereas hybrids are more likely to be heterozygous for those same genes

c. if a gene exists in two alleles, hybrids are more vigorous because heterozygosity for the gene is more beneficial than homozygosity of either allele

d. all of the above are consistent

c