Lab Practical Prep Practice Labs 5-9

Flashcards for vocabulary review of lab practical prep.

What are two important pieces of information missing from the figure legend in graph number 1?

Missing information such as SDH full form and unit, tissue of Bos taurus, statistical analysis information etc.

What is wrong with the axes labels on the scatter plot of mean enzyme activity, and how can this issue be fixed?

The axes labels lack specificity regarding what 'mean' refers to and the corresponding unit. This can be fixed by clarifying the meaning of 'mean' and including the appropriate unit.

Identify an issue with the construction of this scatter plot AND state why it is incorrect.

The inclusion of a horizontal error bar is incorrect in a scatter plot.

Identify another issue with the construction of this scatter plot AND state why it is incorrect.

The malonate concentration on the scatter plot is incorrect because it doesn't start at zero and is not accurate.

How to report the outcome of a one-way ANOVA using three independent data sets in a figure legend?

The mean of three independent data sets is significantly different (ANOVA, p<0.0001) with pairwise analysis showing significant difference in mean M1, M3 (Tukey HSD, p…..), and M2, M3 (Tukey HSD, ……) but not M1 and M2.

Why was a negative control tube (no enzyme) value subtracted from all other enzyme reaction tubes?

To account for DCIP reduction that may happen due to presence of reducing agents other than succinate dehydrogenase that could affect the absorbance measured.

What molecule in Lab 5 reaction was being read by the spec (produced the absorbance value that you recorded)?

DCIP

What were the controls in the independent photosynthesis experiment?

Negative- No light, Positive- white light

Why does photosynthesis result in a rise in solution pH?

In photosynthesis there is consumption of CO2 which leads to rise in solution pH.

What organelle in algae cells is responsible for generating the carbon dioxide that causes the solution to turn acidic in low-light conditions?

Mitochondria

Explain what the compensation point is. How is it related to the products of photosynthesis and the substrates needed for aerobic respiration?

Compensation point is where the rate of photosynthesis is equal to rate of respiration- equilibrium. The production of oxygen from photosynthesis which is the product of respiration and its consumption in respiration to produce CO2, product of respiration and substrate for photosynthesis is at equilibrium.

Which wavelength(s) of light are the best for photosynthesis and why green light does not drive photosynthesis?

Part I- The two wavelengths or range with highest photosynthesis. Part II- Green light is not absorbed, rather reflected and hence does not drive photosynthesis

Which part of the plasmid allows bacterial cells to replicate it when they divide?

Ori

What were the positive and negative controls in transformation experiment? Why were they positive or negative?

Negative Control- transformation setup with control plasmid that does not have GFP.

In a PCR reaction, ____ takes the place of helicase, and enzymes like _____ are not necessary.

high temperature, Primase

How to design 22bp forward and reverse primers to amplify the open reading frame of a sequence?

Forward Primer ATG TCT TAT TCA A… Reverse Primer- Find stop codon and 22 bp from it Find it complement and reverse write it to get it in 5’- >3’ 5’ TCAGTTCTCACAATGTGATGT 3’

What parameter of the PCR reaction would you change in order to amplify a sequence of DNA that is 7500 kb?

Need to increase the extension/elongation time enough to extend 7500kb.