BIOL 2520 - Lecture 9 (Transcription: DNA to RNA)

How do cells become different from each other?

1.) Different cells produce a different subset of proteins, which is what makes them specialized in both structure and function.

2.) The production of different proteins is because different cells express different genes.

Expression of genes

1.) Human cells contain roughly 22,000 genes, but only a fraction of them are ever expressed in any one cell.

2.) Some genes are expressed in all cells, at all times

3.) Others are expressed only when a cell begins to differentiate

4.) Some are expressed only in cells with specialized functions

5.) Others are expressed only when surrounding conditions change and they receive a signal to express or silence a gene.

Housekeeping genes

1.) These are the genes that are expressed in all cells at all times.

2.) They are responsible for the routine metabolic functions that are common to all cells.

Key steps in the expression of a protein-coding gene

1.) Transcription

2.) Processing

3.) Transportation out of the nucleus

4.) Translation

5.) Protein folding and modification

6.) The protein is now expressed and can carry out its specific function

Transcription (for making a protein)

RNA polymerase II transcribes a complementary RNA sequence from the DNA template, resulting in a single-stranded pre-mRNA molecule, which is then processed into mature mRNA.

Processing

The pre-mRNA transcript from transcription undergoes processing to form the finalizalied messenger RNA strand

Translation

The mature mRNA complexes with a ribosome, so that its information can be translated into an ordered polymer of amino acids.

Overview of transcription

DNA is transcribed into RNA using DNA-dependant RNA polymerases, which are multi-unit enzymes that can incorporate nucleotides into a strand of RNA using DNA as a template.

Why are RNA polymerases “DNA dependant”

Because they require DNA as a template to form the strand of RNA

RNA polymerase I

Transcribes 5.8S, 18S, adn 28S rRNA genes

RNA polymerase II

Transcribes…

1.) All protein-coding genes (aka mRNA)

2.) snoRNA genes

3.) miRNA genes

4.) siRNA genes

5.) lncRNA genes

6.) most snRNA genes

RNA polymerase III

Transcribes

1.) tRNA genes

2.) 5S rRNA genes

3.) Some snRNA genes

4.) And genes for other small RNAs

How RNA polymerase II transcribes mRNA

1.) It unwinds the DNA strands

2.) It reads the DNA template strand in the 3’ to 5’ direction

3.) It then catalyzes the polymerization of ribonucleotides in the 5’ to 3’ direction, by adding the 5’-phosphate of the next base to the 3’-hydroxyl of the previous base.

4.) It uses ATP, GTP, CTP, and UTP as substrates

In which direction is an RNA chain synthesized?

1.) 3′-to-5′ only

2.) 5′-to-3′ only

3.) It depends on which DNA strand acts as the template.

4.) It depends on which RNA polymerase does the transcribing.

2.) 5′-to-3′ only

The following is a portion of the DNA sequence from the beginning of a gene that codes for a protein. The bottom strand is the coding strand. What is the sequence of the mRNA produced from this region of the gene?

5′ CCTATGTACTTCGAGGTACATCGC 3′

3′ GGATACATGAAGCTCCATGTAGCG 5′

5′ GCGAUGUACCUCGAAGUACAUAGG 3′

Coding strand vs Template strand vs Transcript

The template strand is the one being read, but the coding strand is the strand the transcript will be identical to, except the T’s are replaced with U’s.

Which of the following is transcribed by RNA polymerase II?

A. 5S rRNA

B. 5.8S rRNA

C. mRNA

D. tRNA

C. mRNA

Which of the following is transcribed by RNA polymerase III?

A. tRNA

B. mRNA

C. miRNA

D. 5.8s rRNA

A. tRNA

The core promoter

1.) It is where the RNA polymerase binds to prior to initiating transcription.

2.) It is located upstream (before) of the transcriptional start site.

RNA polymerase recognizing the promoter

1.) It requires the help of general transcription factors to recognize a specific part of the promoter, specifically the TATA box, which is located 24-32 bases upstream from the initiation site.

2.) It does this by forming a PIC (pre-initiation complex).

TATA box

It is a critical part of the eukaryotic promoter, which lies 24-32 bases upstream (before) the initiation site.

Orientation of the promoter

DNA can be read in either direction, depending on the orientation of the promoter.

Twenty base pairs are added between a TATA box sequence and the transcription start site. How will this affect transcription at that promoter?

A. Transcription will occur, but will start 20 bases upstream from where it normally would.

B. Transcription will occur, but will start 20 bases downstream from where it normally would.

C. Transcription will occur, but will stop 20 bases upstream from where it normally would.

D. Transcription will not occur.

A. Transcription will occur, but will start 20 bases upstream from where it normally would. It would start 20 bases upstream rather than downstream, because the start site is always 24-32 after the TATA, therefore it does not matter where the original start site is.

Formation of the PIC (steps 1-2)

1.) It starts with the binding of the TATA-binding protein (TBP) to the promoter, along with TFIID, thereby causing a conformational change in the DNA

2.) TFIIB and IFIIA then bind to the promoter where the TFIID and TBP are.

Formation of the PIC (steps 3-4)

3.) The three GTFs (general transcription factors) bound to the promoter allows for the binding of RNA polymerase II, along with TFIIF.

4.) TFIIH, followed by TFIIE, are then recruited to complete the formation of the PIC. TFIIH helps open up and unwind the DNA.

After the formation of the PIC

1.) Once the PIC has completely formed, transcription begins by bringing in the ribonucleotides.

2.) This releases the GTFs, which allows the elongation factors to be brought in.

What happens if the TFIID remains bound to the promoter.

1.) It can keep recruiting RNA polymerases for additional rounds of transcription, such that multiple mRNAs can be made from the same gene at once (aka amplification).

2.) From each of these mRNAs, multiple proteins can then be translated.

General order that the PIC is made

1.) TBP + TFIID

2.) TFIIB + TFIIA

3.) RNA polymerase II + TFIIF

4.) TFIIH

5.) TFIIE

Arrange the following components of the eukaryotic transcriptional machinery in the sequence in which they bind to the promoter to assemble the transcriptional preinitiation complex:

1. Polymerase II

2. TBP

3. TFIIB

4. TFIIE

TBP —> TFIIB —> Polymerase II —> TFIIE

What is the mRNA called before it is processed

It is known as the precursor-mRNA or pre-mRNA

C-terminal domain of the RNA polymerase

It gets phosphorylated, allowing it to serve as a scaffold for other factors that are involved in RNA processing, so that the growing pre-mRNA can be processed as it is being made

Processing pre-mRNA into mRNA

1.) Needs a 5’ cap

2.) It is polyadenylated to form the 3’ poly-A-tail

3.) The introns are spliced out to join the extrons

Genes in eukaryotic cells often have intronic sequences coded for within the DNA. These sequences are ultimately not translated into proteins. Why?

A. Intronic sequences are removed from RNA molecules by the splicing, which works in the nucleus.

B. Introns are not transcribed by RNA polymerase.

C. Introns are removed by catalytic RNAs in the cytoplasm.

D. The ribosome will skip over intron sequences when translating RNA into protein.

A. Intronic sequences are removed from RNA molecules by the splicing, which works in the nucleus.

5’ cap structure

1.) A modified form of guanosine that has a methyl group added to its 7th atom.

2.) It is an “inverted” guanine nucleotide that is added by forming a 5’ to 5’ bond on the 5’-phosphate of the RNA transcript.

Functions of the 5’ cap

1.) It stabilizes the 5’ end, thereby protecting it from exonucleases.

2.) It aids in the transport of the mRNA out of the nucleus

3.) It helps start the translation process

Precise splicing of introns

Introns must be removed with precision, one base off and the translation of the protein will be wrong (such that it is shortened).

Splice-sites

1.) They are highly conserved, recognizable sequence regions that are recognized for splicing.

2.) It usually has a consensus sequence, such that it is the same for almost all genes

Consensus sequence of splice-sites

1.) Usually, introns have a GU at the 5’ end, a G at the 3’ end, and an A in the middle.

2.) The A plays a very important part in the splicing process.

Chemistry of splicing

1.) The 2’-OH of the adenine in the middle of the intron attacks the phosphate group at the beginning of the intron, causing exon 1 and the intron to disconnect.

2.) Exon 1 is left with an OH-group which then attacks the phosphate at the end of the intron, which disconnects the intron from exon 2 and joins the two exons together.

3.) Resulting in the formation of a lariat (released intron) and the joined exons.

Mechanism of splicing

1.) Splicing is done by a number of protein/RNA molecules, via the formation of snRNPs and spliceosomes

2.) The RNA molecules recognizes and binds to the splice-sites on the intron ends and have catalytic activity that helps splice out the introns

snRNPs

1.) A complex of small nuclear RNAs (snRNAs) that bind to proteins, with RNAs having the ability to recognize the splice-sites by base-pairing.

2.) The snRNPs eventually come together to form a spliceosome

Spliceosome

1.) The complex of two snRNPs that does the actual splicing of the intron, using the catalytic activity of the snRNPs.

2.) It is formed in the nucleus, where transcription takes place.

3.) It leaves the mRNA along with the lariat.

How the spliceosome works (steps 1-3)

1.) U1 and U2 base-pairs to the splice-sites on the introns

2.) U1 is then replaced by U6, which base-piars with U2 to form the spliceosome

3.) The splicing is carried out in the active site of the spliceosome

How the spliceosome works (steps 4-5)

4.) The intron is excised out in the form of the lariat, bringing the spliceosome along with it

5.) An exon junction complex is placed where the exons are connected, for stability.

Alternative splicing

1.) It allows many different proteins to be produced from the same gene, because an exon in one mRNA can be an intron in another and vice versa.

2.) This can help expand the proteome of a cell

Different proteins encoded by the same gene are called…

Splicing isoforms of the protein

Example of alternative splicing leading to splicing isoforms

1.) The splicing of Bcl-x can result in two mRNAs (i.e. two proteins)

2.) In one mRNA, exon 2 remains intact, resulting in a large Bcl-x protein that inhibits programmed cell death. It is commonly seen in tumor cells

3.) In the other mRNA, exon 2 is shortened, resulting in a small Bcl-x protein, which induces cell death.

Two processing events that occur at the 3’ end of the mRNA

1.) Cleavage of the mRNA from RNA polymerase II

2.) Addition of the Poly-A-tail

Cleavage of the mRNA at the 3’ end

An enzyme cuts the growing mRNA chain at a particular sequence on the strand, which separates the mRNA from the transcribing RNA polymerase II

Addition of Poly-A-tail

After the RNA has been cleaved, a special type of RNA polymerase adds 50-250 adenosine residues to the 3’ end of the cleaved mRNA

Functions of the 3’ Poly-A-tail

1.) It increases the stability of a eukaryotic mRNA molecule

2.) It facilitates the export of the mRNA from the nucleus to the cytosol

After polyadenylation

The RNA polymerase dissociates from the DNA template and transcription is terminated.

Which of the following statements about RNA splicing is FALSE?

A. Conventional introns are not found in bacterial genes.

B. For a gene to function properly, every exon must be removed from the primary transcript in the same fashion on every mRNA molecule produced from the same gene.

C. Small RNA molecules in the nucleus perform the splicing reactions necessary for the removal of introns.

D. Splicing occurs after the 5′ cap has been added to the end of the
primary transcript.

B. For a gene to function properly, every exon must be removed from the primary transcript in the same fashion on every mRNA molecule produced from the same gene.

When does splicing happen?

It occurs after the 5’ cap has been added

Your friend learns about splicing and fails to understand the benefit of this “wasteful operation.” What reason can you give to convince her of the benefit of splicing?

A. Splicing can allow different proteins to be produced from the same prokaryotic gene.

B. Splicing will allow eukaryotes to decrease the coding potential of their genome.

C. Splicing can allow different proteins to be produced from the same eukaryotic gene.

D. Splicing can allow prokaryotes to increase the potential of their genome

C. Splicing can allow different proteins to be produced from the same eukaryotic gene.

Researchers often want to isolate a certain type of RNA. For some RNA species, this can be accomplished via affinity chromatography, using beads coated with chains of poly-deoxythymidine (poly-dT) (5′-TTTTTTTTTTTTTTTTTTTTTTTTT-3′). The desired RNA will stick to the beads while unwanted RNAs will flow through the column. The retained RNA can then be eluted. What RNA species can be purified using this method?

A. Viral RNA

B. Bacterial ribosomal RNA

C. Bacterial messenger RNA

D. Eukaryotic mRNA

D. Eukaryotic mRNA, because the poly-A-tail of eukaryotic mRNA can attach to the poly-dT tail.

miRNA

Aka microRNA, which regulates gene expression

siRNAs

1.) Aka small interfering RNAs

2.) It provides protection against viruses and proliferating transposable elements

lncRNAs

1.) Aka long noncoding RNA

2.) It acts as a scaffold and is able to serve a diverse set of functions, many of which are still being discovered.

Termination of transcription:

A. ends automatically at the end of the mRNA chain.

B. is sequence specific.

C. is coordinated with the addition of the 5′ cap.

D. is most like an extended pause of transcription

B. is sequence specific.

Export of mRNA to the cytosol

After the mRNA has been processed and modified they are exported out of the nucleus by a specialized set of RNA-binding proteins, which recognizes different parts of a mature mRNA molecule.

Prokaryotic transcription

1.) The 5’ end of an mRNA molecule is produced by the initiation of transcription by RNA polymerase

2.) The 3’ end is produced by the termination of transcription

3.) The translation of prokaryotic mRNA begins before the synthesis of the mRNA has been completed

Translation and transcription of prokaryotes

It happens at the same time and occurs in the same compartment

Translation of prokaryotic and eukaryotic mRNA

Prokaryotic mRNA can lead to the production of multiple proteins (due to polycistronic mRNA) and eukaryotic mRNA leads to only one protein

Modification of prokaryotic mRNA

It has no 5’ cap and no poly-A-tail and it rarely has any introns.

What is true of eukaryotic mRNAs?

A.They are synthesized and translated simultaneously.

B. They must always be folded into a complex three-dimensional shape before they can be translated.

C. They are translated after they are exported from the nucleus.

D.They are subjected to processing only after being released by the polymerase.

C. They are translated after they are exported from the nucleus.

What is true of eukaryotic mRNAs? WHY IS D FALSE?

A.They are synthesized and translated simultaneously.

B. They must always be folded into a complex three-dimensional shape before they can be translated.

C. They are translated after they are exported from the nucleus.

D.They are subjected to processing only after being released by the polymerase.

False because they’re processed as the mRNA is being made and not when it is released by the polymerase.