BIS

0.0(0)
Studied by 1 person
call kaiCall Kai
Locked
learnLearn
examPractice Test
spaced repetitionSpaced Repetition
heart puzzleMatch
flashcardsFlashcards
GameKnowt Play
Card Sorting

1/193

flashcard set

Earn XP

Description and Tags

Last updated 6:54 AM on 12/8/22
Name
Mastery
Learn
Test
Matching
Spaced
Call with Kai
Chat

No analytics yet

Send a link to your students to track their progress

194 Terms

1
New cards
. In eukaryotes, transcription and processing of mRNAs occurs in the _____, while translation occurs in the _________.
A. nucleus, golgi
B. nucleus, cytoplasm
C. cytoplasm, nucleus
D. cytoplasm, golgi
E. golgi, nucleus
B. nucleus, cytoplasm
2
New cards
"Antennapedia" is a mutant trait in fruit flies, in which the antennae are converted into forelegs. It is a dominant trait. We cross two flies together, one of which displays the trait. We then take one normal female and her antennapedia brother from among their progeny, and cross them together. What is the expected ratio of phenotypes among their offspring?
a. 50 wild-type : 50 mutant
b. 75 wild-type : 25 mutant
c. 25 mutant : 75 wt
d. 100% wild-type
!e. It is impossible to say given the information provided.
a. 50 wild-type : 50 mutant
3
New cards
"Pumps" push solutes up/against a gradient. Because this activity increases the potential energy stored in the gradient, the cell "pays" for this through...
a. hydrolysis of ATP
b. counter-flow of another solute down a gradient
c. the formation of ATP
d. two of the above activities might power a biological "pump"
e. Increasing potential energy is energetically favorable- it doesn't have to be "paid for"
d. two of the above activities might power a biological "pump"
4
New cards
"Translation" means translating what into what?
a. DNA into its complementary strand
b. DNA into RNA
c. RNA into DNA
d. RNA into Protein
e. Protein into RNA
d. RNA into Protein
5
New cards
) A eukaryotic chromosome is typically ________ and it is replicated ________ _______.:
a. linear, from a single origin
b. linear, from multiple origins
c. linear, from two terminal origins
d. circular, from a single origin
e. circular, from multiple origins
b. linear, from multiple origins
6
New cards
) If the organism to which this cell belongs is heterozygous for the W gene (genotype Ww), the following applies (6 pt)

answer
if G carries the following
then H carries
and L carries
a
WW
ww
No allele of w
b
W
w
Ww
c
WW
w
No allele of w
d
Ww
WW
No allele of w
e
No allele of w
w
W
a.
WW
ww
No allele of w
7
New cards
2-4 dinitrophenol can transport protons from one side of a lipid bilayer to the other. Cells treated with this compound would be expected to:
a. Need more O2 to oxidize each NADH
b. Need more ADP to make each ATP
c. Need more glucose to make each ATP
d. Make ATP more efficiently as protons do not need to be transported by cellular proteins.
e. both c and d
c. Need more glucose to make each ATP
8
New cards
A cell containing virtually no solute "X" is placed into medium containing X, and the initial rate of transport into the cell is measured (measuring how much gets into the cell in 30 seconds). Figure CURVE depicts the initial rate of transport of solute X into a cell vs. the concentration of solute X in the medium outside of the cell. What does this figure tell us about the mechanism of transport of X?
a. Transport can be saturated, which indicates there are a finite number of transporter molecules for X on the cell's surface.
b. X can diffuse directly into the cell, without a transporter.
c. X requires active transport.
d. X is transported by a proton/X symporter.
e. Transport of X occurs only at very low concentrations of X.
a. Transport can be saturated, which indicates there are a finite number of transporter molecules for X on the cell's surface.
9
New cards
A cell has an interior concentration of K+ that is quite high, and is placed in an environment in which the concentration of K+ is relatively low. The cell is found to transport K+ from its environment into the cell. Such transport is referred to as _____ and requires _______.
A. diffusion, swelling
B. passive transport, an influx of water
C. active transport, and cell shrinkage
D. active transport, and a source of energy
D. active transport, and a source of energy
10
New cards
A cell in the G2 phase of the cell cycle undergoes meiosis, producing four spores, each in G1 phase. The original G2 cell's nucleus contained 4 picograms of DNA. How many picograms of DNA are present in each of the G1 spores?
a. 8 picograms
b. 4 picograms
c. 2 picograms
d. 1 picogram
e. 0 picograms
d. 1 picogram
11
New cards
A DNA sequence reads: 5' ATCGATCG 3'
The sequence of the strand annealing to it (= the complementary strand) would read
a. 5' CGATCGAT 3'
b. 5' TAGCTAGC 3'
c. 5' GCATGCAT 3'
d. 5' ATCGATCG 3'
e. 5' TACGTACG 3'
a. 5' CGATCGAT 3'
12
New cards
A DNA sequence reads: 5' GCGTTAGC 3'
The sequence of the strand annealing to it (= the complementary strand) will read
A. 5' CGCAATCG 3'
B. 5' GCTAACGC 3'
C. 5' GCUAAGCG 3'
D. 5' CGCAAUGC 3'
E. 5' CGATTGCC 3'
B. 5' GCTAACGC 3'
13
New cards
A DNA sequence, which can be distant (many kilobases) from a gene and either 5' or 3' of the coding region, activates transcription when bound by an activator protein. Such a sequence is called a(n)
a. TATA box
b. operon
c. enhancer
d. Promoter
e. silencer
c. enhancer
14
New cards
A gene is mutated, changing a codon from GGG (glycine) to GAG (glutamic acid). As a result, we'd predict that...
a. the protein's primary structure will change, and its tertiary structure might change
b. the protein's primary structure will change, and its tertiary structure will too.
c. the protein's primary structure might change, and its tertiary structure might change.
d. the protein's primary structure might change, and its tertiary structure will change
e. We can't make any predictions about the protein's structure.
a. the protein's primary structure will change, and its tertiary structure might change
15
New cards
A gene is mutated, changing a codon from GGG (glycine) to GAG (glutamic acid). As a result...
a. the protein's primary structure will change, and its tertiary structure might change
b. the protein's primary structure will change, and its tertiary structure will too.
c. the protein's primary structure might change, and its tertiary structure might change.
d. the protein's primary structure might change, and its tertiary structure will change
e. We can't make any predictions about the protein's structure.
a. the protein's primary structure will change, and its tertiary structure might change
16
New cards
A helicase is required for DNA replication. Helicases...
a. excise mismatched bases
b. charge tRNAs with amino acids
c. degrade RNA primers
d. seal up nicks in the backbone of DNA
e. separate the two strands of the double helix
e. separate the two strands of the double helix
17
New cards
A mutant is isolated with a mutation in the trp operator that prevents binding of the trp repressor. Such a mutant would be expected to:
a. Strongly and constitutively express the trp operon
b. Strongly express the trp operon only in the presence of trp
c. Strongly express the trp operon only in the presence of lactose
d. Strongly express the trp operon only when trp is absent
e. Strongly express the trp operon only the presence of high concentration of cAMP.
a. Strongly and constitutively express the trp operon
18
New cards
A mutant is isolated with a nonsense mutation in the 5' end of the RNA encoding the lac repressor. Such a mutant would be expected to:
a. Strongly and constitutively express the lac operon
b. Strongly express the lac operon only in the presence of trp
c. Strongly express the lac operon only in the presence of lactose
d. Strongly express the lac operon only when lactose is absent
e. Strongly express the lac operon only the presence of high concentration of cAMP.
e. Strongly express the lac operon only the presence of high concentration of cAMP.
19
New cards
A mutant with a knockout in the A gene would be expected to have what phenotype? Organs are listed from the outside of the flower to the center of the flower.
a. carpel stamen stamen carpel
b. stamen carpel stamen carpel
c. carpel petal stamen carpel
d. sepals- just a bunch of sepals
a. carpel stamen stamen carpel
20
New cards
A mutation occurs in the lac repressor gene that results in a protein that cannot bind lactose, but can still recognize the lac operator. How would this affect the expression of the lac operon?
A. It wouldn't affect it.
B. Would not be expressed only in the absence of glucose
C. It would be expressed all the time
D. It would never be expressed
E. It would be expressed only when lactose is absent.
D. It would never be expressed
21
New cards
A nonsense mutation is ...
A. When the two bases in the double helix don't match
B. When the sequence of a codon is changed, but its meaning is not.
C. A mutation that changes the amino acid encoded
D. A frameshift mutation
E. A mutation to a stop codon
E. A mutation to a stop codon
22
New cards
A population of cats on an island is at Hardy-Weinberg equilibrium. On this island cats are either black, orange, or tortoise shell. Orange is an X-linked trait in cats. Cats carrying only the mutant chromosome (XoY or XoXo) are orange, those carrying only the wild-type version of X are black. Cats carrying both Xo and X are tortoise shell. If 64% of females are black, what's the frequency of black males?
a. 80%
b. 64%
c. 36%
d. 18%
e. 20%
a. 80%
23
New cards
A protein that forms an ion channel across a membrane is most likely to be:
a. A peripheral protein
b. A transmembrane protein
c. A phospholipid
e. Entirely outside the phospholipid bilayer
b. A transmembrane protein
24
New cards
A researcher builds a new version of the B gene using a promoter that is expressed in all floral organs. What is the expected phenotype of the plant transformed with this new gene?
a. carpel stamen stamen carpel
b. sepal sepal sepal sepal
c. petal petal carpel carpel
d. petal petal stamen stamen
e. carpel carpel petal petal
d. petal petal stamen stamen
25
New cards
A researcher transforms the pollen of wild-type Arabidopsis with a gene that encodes the "B" gene required for floral organogenesis (see Figure 11), but in this synthetic gene she has replaced the B gene's promoter with the promoter that drives the "C" gene. The pollen is then used to fertilize a wild-type plant. Based on the ABC model and your understanding of promoters, you would predict the following phenotype in the flowers of the resulting transgenic offspring:
a. Sepal, petal, carpel, carpel
b. sepal, sepal, carpel, carpel
c. petal, petal, stamen, stamen
d. Sepal, petal, Stamen, Stamen
e. Stamen, stamen, petal, sepal
d. Sepal, petal, Stamen, Stamen
26
New cards
A retroviral genome carries a mutation that results in a stop codon early in the coding sequence for the viral coat protein (= capsid protein). Such a mutation would make the virus unable to:
a. Integrate into the host genome
b. generate more copies of itself
c. infect other cells
d. a and c
e. b and c
c. infect other cells
27
New cards
A retrovirus encodes at least three proteins important to its life cycle. Loss of the reverse transcriptase gene would most directly result in permanent loss of the virus ability to:
A. infect other cells
B. produce mRNA
C. integrate into the host genome
D. reverse transcribe its RNA into DNA
E. all of the above
D. reverse transcribe its RNA into DNA
28
New cards
A universal feature of signal receptor proteins is that they..
A. Are protein kinases
B. Are membrane bound
C. Transport substances across a membrane
D. Are degraded in the presence of the signal
E. undergo a change in shape when the signal molecule is bound
E. undergo a change in shape when the signal molecule is bound
29
New cards
A very short message has the sequence...
5' ACGCCGAUCAUGUUCGGCAUGCGAGUAUAAAAACUGG 3'
How many amino acids are encoded by this message?
A. 12
B. none
C. 4
D. 7
E. 6
E. 6
30
New cards
According to the fluid mosaic model of the cell membrane, a transporter protein with an extracellular hydrophilic domain and a cytoplasmic hydrophilic domain should be able to:
a. Glide freely within the plane of the membrane, allowing it to react with various other membrane proteins
b. Flip across the membrane- allowing the extracellular domain to become cytoplasmic, and the cytoplasmic domain to be located outside the cell (so that transport can reverse direction)
c. Both a and b
d. Neither a nor b
a. Glide freely within the plane of the membrane, allowing it to react with various other membrane proteins
31
New cards
According to the fluid mosaic model of the cell membrane, a transporter protein with an extracellular hydrophilic domain and a cytoplasmic hydrophilic domain should be able to:
a. Glide freely within the plane of the membrane, allowing it to react with various other membrane proteins
b. Flip across the membrane- allowing the extracellular domain to become cytoplasmic, and the cytoplasmic domain to be located outside the cell (so that transport can reverse direction)
c. Both a and b
d. Neither a nor b
e. The fluid mosaic model indicates that protein cannot move if embedded in a membrane.
a. Glide freely within the plane of the membrane, allowing it to react with various other membrane proteins
32
New cards
According to the regulatory scheme above, if plants are treated with gamma radiation (which induces double strand breaks) and then grown in the presence of light, the plants will:
a. Kill cells in their roots, switch on repair in leaves
b. Kill cells in roots, switch off repair in leaves
c. Turn off auxin synthesis, activate the SOG1 protein
d. Turn on auxin synthesis, inactivate SOG1 protein
e. Activate ATM kinase, turn off auxin synthesis
a. Kill cells in their roots, switch on repair in leaves
33
New cards
Addition of a catalyst to the above reaction will:
a. Increase the ∆G
b. Decrease the ∆G
c. Decrease the activation energy
d. Increase the activation energy
e. Change the equilibrium value
c. Decrease the activation energy
34
New cards
Alpha helices and Beta pleated sheets are examples of:
A. Protein primary structure
B. Protein secondary structure
C. Protein tertiary structure
D. Protein quaternary structure
B. Protein secondary structure
35
New cards
An E. coli mutant carries a mutation that knocks out the CRP gene (also known as CAP). What is the predicted effect on the regulation of the Trp operon?
a. The operon would be off all the time
b. The operon would be on all the time
c. The operon would be on, but only in the presence of tryptophan
d. A defect in CRP would have no effect on the regulation of the Trp operon.
d. A defect in CRP would have no effect on the regulation of the Trp operon.
36
New cards
An individual inherits a mutation in a gene associated with breast cancer. In which cells is this allele located?
a. Only in cells of the breast where cancer occurred.
b. Only in cells of both breasts.
c. Only in those cells found in females.
d. Only in the cells of the breast and ovaries.
e. All the cells of the individual.
e. All the cells of the individual.
37
New cards
An mRNA encoding a cell membrane protein would be translated in the following location:
a. The nucleus
b. The cytoplasm
c. The nuclear membrane
d. The mitochondrion
b. The cytoplasm
38
New cards
An operon encoding an anabolic pathway is generally regulated as follows:
a. The small molecule that is the precursor for that pathway (=substrate for the first step) represses expression of the operon
b. The small molecule that is the product of the entire pathway represses transcription of the operon
c. The small molecule that is the product of the pathway induces transcription of the operon
d. An intermediate in the pathway represses transcription of the operon
e. An intermediate in the pathway induces transcription of the operon
b. The small molecule that is the product of the entire pathway represses transcription of the operon
39
New cards
An operon encoding an anabolic pathway is generally regulated as follows:
a. The small molecule that is the precursor for that pathway (=substrate for the first step) represses expression of the operon
b. The small molecule that is the product of the entire pathway represses transcription of the operon
c. The small molecule that is the product of the pathway induces transcription of the operon
d. An intermediate in the pathway represses transcription of the operon
e. An intermediate in the pathway induces transcription of the operon
b. The small molecule that is the product of the entire pathway represses transcription of the operon
40
New cards
Anaerobic respiration yields fewer ATPs per NADH than aerobic respiration because...
A. Respiration can't occur in the absence of O2.
B. Fermentation is naturally inefficient
C. O2 is a very powerful oxidizing agent
D. O2 is a very powerful reducing agent
E. O2 has always been plentiful in the Earth's atmosphere
C. O2 is a very powerful oxidizing agent
41
New cards
ATP is used as an "energy currency of the cell" because:
A. The diphosphate bond is unusually stable, for a covalent bond
B. Hydrolysis of the diphosphate bond has a high positive ∆G
C. Hydrolysis of the diphosphate bond has a high negative ∆G
D. ATP is a building block of DNA
E. Both a and d
C. Hydrolysis of the diphosphate bond has a high negative ∆G
42
New cards
Bacteria solve the problem of coordinate regulation of genes in response to environmental signals by:
a. Placing the responding genes under the control of a single promoter, and transcribing all together on a single RNA
b. Placing the responding genes under the control of promoters containing similar regulatory sequences
c. Modifying the tails of the histones at the genes
d. expression of silencing RNAs
e. Both a and b
e. Both a and b
43
New cards
Bacteria tend to locate their genes in functional clusters (operons)- where the all or many of the genes involved in a pathway, and their regulatory sequences, will be co-located. In eukaryotes, however, the genes involved a biosynthetic pathway are randomly distributed throughout the genome. Why does this discrepancy exist?
a. The eukaryotic genome is older, and the genes have moved apart due to random mutations
b. DNA is inherited almost exclusively via vertical, rather than horizontal, transmission in eukaryotes
c. DNA is often inherited via horizontal, as well as vertical, transmission in prokaryotes
d. Meiotic recombination breaks up gene clusters in eukaryotes, but not prokaryotes
e. Meiotic recombination breaks up gene clusters in prokaryotes, but not eukaryotes
c. DNA is often inherited via horizontal, as well as vertical, transmission in prokaryotes
44
New cards
Bacteria, Archaea, and Eukarya represent the three major subdivisions of living organisms. Bacteria share _______with archaea, and archaea share _____with eukarya .
a. multicellularity, monolayer membrane
b. monolayer membrane, multicellularity
c. histones, lack of introns
d. unicellularity, histones
e. lack of introns, meiosis
d. unicellularity, histones
45
New cards
Based on DNA sequence similarities, the mitochondrion is thought to have evolved from:
a. An alpha-proteobacterium that could both respire and produce hydrogen
b. The endoplasmic reticulum
c. The hydrogenosome
d. The plastid
e. An aberrant cell division that maintained one cell inside the other
a. An alpha-proteobacterium that could both respire and produce hydrogen
46
New cards
Both fermentation and respiration share the metabolic pathway termed "glycolysis". They also share...
a. a step involving oxidation of pyruvate
b. a step involving reduction of pyruvate
c. oxidative phosphorylation of ATP
d. oxidation of NADH via the ETC
e. none of the above
e. none of the above
47
New cards
Cell walls allow cells to:
a. Avoid the explosive effects of pure water
b. Engulf and devour other cells
c. Keep small molecules out of the cell, if they are polar or charged
d. Perform cell division
e. Become multicellular
a. Avoid the explosive effects of pure water
48
New cards
Cells that have cell walls can't:
a. Resist osmotic shock
b. Be heterotrophic
c. Engulf other cells
d. Be autotrophic
!e. Both b and c are true
c. Engulf other cells
49
New cards
Chromatin silencing is often observed in eukaryotes, but not prokaryotes. Chromatin silencing may have evolved to cope with:
a. The lack of operons in the eukaryotic genome
b. The high mutational load found in eukaryotic genomes
c. The high number of transposons and retrotransposons in the eukaryotic genome
d. The very compact (many genes per kilobase pair) genome size of most eukaryotes
e. The presence of centrosomes in eukaryotes
c. The high number of transposons and retrotransposons in the eukaryotic genome
50
New cards
Cohesins are proteins that bind sister chromatids together. If a cell is treated with a poison that prevents cohesins from forming a "handcuff" around sister chromatids, we'd expect the cell to be able to perform ________ but not __________.
a. DNA replication, chromatid segregation
b. DNA replication, crossing over
c. Segregation, cell division
d. Prophase, metaphase
e. DNA repair, DNA replication
a. DNA replication, chromatid segregation
51
New cards
Consider a short polar charged region and a short non-polar region in a long polypeptide chain. When dissolved in water, the polypeptide will most likely fold to form a protein in which:
a. The non-polar region is exposed on its surface and the polar region is interior.
b. The polar region is exposed on its surface and the non-polar region is interior.
c. both the non-polar and the polar region are exposed on its surface.
d. both the non-polar region and the polar region are interior.
b. The polar region is exposed on its surface and the non-polar region is interior.
52
New cards
Consider the following chemical reaction: A + B goes to C. In figure 3, the dashed line represents the energetics of this reaction WITHOUT an enzyme. Which of the explanations below can explain the solid line labeled '(b)' in the diagram?
a. Line B represents the reaction if enzyme has been added to the reaction.
b. Line B represents the reaction if heat were added to the reaction.
c. Line B represents the amount of enzyme required to turn A+B into product C.
d. None of the above
e. All of the above
a. Line B represents the reaction if enzyme has been added to the reaction.
53
New cards
Consider the free energy diagram below, which describes the energy states of molecules undergoing the reaction X <-> Y. Raising the temperature of the reaction would reduce the size of which arrow?
A. a
B. b
C. c
D. d
E. none of the arrows would decrease, they would only increase with increased temperature.
B. b
54
New cards
Constitutive promoters are
A. Strong or attractive RNA polymerase binding sequences,
B. RNA polymerase binding sequences that are negatively regulated,
C. RNA polymerase binding sequences that are always "on" without help from additional transcription factors
D. RNA polymerase binding sequences that are positively regulated
E. Promoter sequences that only transcribe multigene operons
C. RNA polymerase binding sequences that are always "on" without help from additional transcription factors
55
New cards
Constitutive promoters in bacteria are
a. Able to be transcribed without the help of RNA polymerase.
b. RNA polymerase binding sequences that are negatively regulated
c. RNA polymerase binding sequences that are always available for binding without help from additional transcription factors
d. RNA polymerase binding sequences that are positively regulated
e. Promoter sequences that only transcribe multigene operons
c. RNA polymerase binding sequences that are always available for binding without help from additional transcription factors
56
New cards
Crossing over during meiosis results in:
a. Changes in the order in which genes are present on the chromosome
b. Changes in combinations of alleles on each chromosome
c. Changes in the combinations of genes on each chromosome
d. b and c
e. c and d
b. Changes in combinations of alleles on each chromosome
57
New cards
Crossing over during meiosis results in:
a. Changes in the order in which genes are present on the chromosome
b. Changes in combinations of alleles on each chromosome
c. Changes in the combinations of genes on each chromosome
!d. b and c
!e. c and d
b. Changes in combinations of alleles on each chromosome
58
New cards
Cyanide (CN-) closely resembles molecular oxygen, and binds tightly to cytochrome C oxidase, the electron carrier that reduces O2 during respiration. Brain cells cannot ferment glucose, but have to respire to utilize glucose. Cyanide is deadly to brain cells because in its presence:
a. O2 builds up in the cell
b. ATP cannot be synthesized from ADP
c. ADP cannot be produced from ATP
d. NAD+ cannot be generated from NADH
e. b and d
e. b and d
59
New cards
DNA polymerase's enzymatic activity is:
a. The addition of 5'triphosphate NTPs to the 3'OH of a growing chain, producing free pyrophosphate (PPi)
b. The addition of 5'triphosphate dNTPs to the 3'OH of a growing chain, producing free pyrophosphate (PPi)
c. The addition of 3'triphosphate dNTPs to the 3'OH of a growing chain, producing free pyrophosphate (PPi)
d. The addition of 3'triphosphate NTPs to the 3'OH of a growing chain, producing free pyrophosphate (PPi)
e. The addition of 3'triphosphate NTPs to the 5'OH of a growing chain, producing free pyrophosphate (PPi)
b. The addition of 5'triphosphate dNTPs to the 3'OH of a growing chain, producing free pyrophosphate (PPi)
60
New cards
Enhancers are frequently found in eukaryotic genes, but not in prokaryotic genes. One possible explanation for this difference is:
a. The prokaryotic genome is too compact to include regulatory sequences
b. The prokaryotic genome is too large for enhancers to function
c. The density of genes (#genes per kilobase) is too high for enhancers to specifically affect a single operon
d. An operon cannot be regulated by an enhancer
c. The density of genes (#genes per kilobase) is too high for enhancers to specifically affect a single operon
61
New cards
Enzymes are used for virtually every chemical reaction in the cell. Enzymes make life possible by:
A. Enhancing reaction rate
B. Enhancing substrate-specificity
C. Enabling the cell to control the direction of a reaction
D. All of the above
E. a and b only are correct
D. All of the above
62
New cards
Errors in transcription are not as potentially harmful as errors in replication because:
a. RNA is not copied into more RNA molecules
b. RNA strands have a relatively short life span
c. RNA polymerases proofread and correct the errors
d. a and b are correct
e. a, b, and c are correct
d. a and b are correct
63
New cards
Eukaryotes solve the problem of coordinate regulation of genes in response to signals by:
!a. Placing the responding genes under the control of a single promoter, and transcribing all together on a single RNA
b. Placing the responding genes under the control of promoters containing similar regulatory sequences
c. Having three different RNA polymerases
d. Having transcription occur in a different compartment than translation
!e. All of the above, except "a"
b. Placing the responding genes under the control of promoters containing similar regulatory sequences
64
New cards
Eyes are useless in a lightless environment, and many cave-dwelling species have lost their eyes. This loss might be due to...
a. Their failure to use their eyes
b. Genetic drift
c. Natural selection for eyelessness
d. Natural selection for blindness
e. b and c are possible
e. b and c are possible
65
New cards
Fermentation yields far fewer ATPs/glucose than respiration. Why is this?
a. In fermentation, glucose is completely oxidized- all the way to CO2. The change in potential energy is larger than in respiration.
b. In respiration, glucose is completely oxidized- all the way to CO2. The change in potential energy is larger than in fermentation.
c. Respiration does not require the electron transport chain, thus it is less costly to the cell.
d. Many ATPs are generated in the pyruvate oxidation step.
e. The high level of cyclic AMP feedback-inhibits ATP formation.
b. In respiration, glucose is completely oxidized- all the way to CO2. The change in potential energy is larger than in fermentation.
66
New cards
For complete expression of the Lac operon two criteria must be met: the absence of glucose and the presence of lactose. The reason for this is:
a. All bacteria can use glucose, so it's best to use this up first, before another bacterium does.
b. Glucose catabolism genes are expressed all the time anyway
c. It is a waste of energy to produce proteins that are not needed, therefore, they do not turn on the Lac operon until lactose is available.
d. a and b
e. a, b, and c are all true
e. a, b, and c are all true
67
New cards
Gene duplications are a very common event. One evolutionary advantage to gene duplication is:
A. to increase the genetic load of a cell allowing for a sink to accumulate mutations without effecting gene function,
B. to allow for gene divergence and the formation of new phenotypes or functions,
C. to provide an increase in the cell's DNA content which is correlated with more fitness ,
D. to provide cells with additional copies of genes that are not being used and would otherwise be lost due to selection.
E. all of the above.
B. to allow for gene divergence and the formation of new phenotypes or functions
68
New cards
Green plants...
a. Perform respiration and photosynthesis
b. Just perform photosynthesis
c. Just perform respiration
d. Have mitochondria and plastids
e. both "a" and "d" are true.
e. both "a" and "d" are true.
69
New cards
Green sulfur bacteria are able to use their single photosystem both to generate NADPH and to make ATP. Why are cyanobacteria and green plants forced to use 2 photosystems to do this?
a. Because H2O is a very powerful reducing agent, compared with H2S, so PSII has to be a very strong oxidizer. Which means even activated PSII is a weak reducing agent.
b. Because H2O is a very weak reducing agent, compared with H2S, so PSII has to be a very strong oxidizer. Which means even activated PSII is a weak reducing agent.
c. Because green plants and cyanobacteria cannot do cyclic photophosphorylation
d. Because green plants and cyanobacteria use water as a source of hydrogen, and so do not need to make NADPH
e. Because NADPH is a 2 electron carrier
b. Because H2O is a very weak reducing agent, compared with H2S, so PSII has to be a very strong oxidizer. Which means even activated PSII is a weak reducing agent.
70
New cards
Highly deacetylated histones are frequently found in:
a. The nucleosomes of highly expressed genes
b. Heterochromatin
c. The nucleosomes of silenced genes
d. Euchromatin
e. Both b and c
e. Both b and c
71
New cards
How can deleterious ("bad", nonfunctional) mutations be eliminated?
a) Through DNA replication
b) Through DNA repair
c) Through natural selection
d) Through polymerization
e) Through Watson-Crick base pairing
c) Through natural selection
72
New cards
How does mitosis differ from meiosis I?
a. Chromatin supercoils only in mitosis.
b. The nuclear envelope disappears only in meiosis I.
c. Homologs align in mitosis but not in meiosis I.
d. The sister chromatids separate in mitosis, not in meiosis I
e. Crossing over occurs in mitosis, but not in meiosis.
d. The sister chromatids separate in mitosis, not in meiosis I
73
New cards
How does the surface area to volume ratio (S/V) of a 1 mm cube compare to that of a 3 mm cube?
a. The 3 mm cube has a higher ratio
b. The ratio increases as the cube becomes larger
c. Increasing the volume increases the ratio
d. The ratio decreases as the cube becomes larger
e. The ratio is a constant, for a cube
d. The ratio decreases as the cube becomes larger
74
New cards
If "R" accumulates, which enzyme(s) would "R" most likely "feedback inhibit"
A. "c",
B. "f",
C. "m",
D. A and C (watch out for capital vs lower case here!), how about c and m?
E. B and C how about f and m? I'll use numbers in my exam!
E. B and C how about f and m? I'll use numbers in my exam!
75
New cards
If green algae cells in a buffer solution containing only inorganic salts are placed in a sealed container at room temperature with excess carbon dioxide gas and exposed to light, the cells will:
a. live for many hours and grow.
b. live for several hours, but fail to grow because there is no source of carbon in the buffer solution.
c. live for several hours, but fail to grow because no oxygen is present.
d. die rapidly, because no oxygen is present.
a. live for many hours and grow
76
New cards
If the plants are sprayed with auxin, so that synthesis of auxin isn't required, what would be the expected effects of gamma radiation?
a. The plants wouldn't respond-no induction of repair, no cell death
b. The plants would respond both in the light and the dark
c. The plants would respond in the light, but not the dark
d. The plants would respond in the dark, but not the light
b. The plants would respond both in the light and the dark
77
New cards
If we increase the concentration of A and B:
a. The ∆G of the reaction will go down (become more negative)
b. The ∆G of the reaction will go up (become more positive)
c. The relative concentrations of A+B vs. C+D at equilibrium will change
d. All of the above are true
just a and c are true
a. The ∆G of the reaction will go down (become more negative)
78
New cards
In a certain mutant strain of bacteria, the enzyme leucyl-tRNA synthetase mistakenly attaches isoleucine to leucyl-tRNA 10% of the time instead of attaching leucine. These bacteria will synthesize:
a. proteins in which leucine is inserted at some positions normally occupied by isoleucine.
b. proteins in which isoleucine is inserted at some positions normally occupied by leucine.
c. no abnormal proteins, because the ribosomal translation machinery will recognize the inappropriately activated tRNAs and exclude them from the translation process.
d. no proteins, because the inappropriately activated tRNAs will block translation.
b. proteins in which isoleucine is inserted at some positions normally occupied by leucine
79
New cards
In an operon that encodes the genes required for the synthesis of a cellular product (for example, an amino acid), one would expect the operon would be:
A. Induced by the product
B. Repressed by the product
C. Repressed by the product in the presence of glucose
D. Constitutively expressed
B. Repressed by the product
80
New cards
In cats, S (white paws) is dominant to s (no white). T (tabby, stripes) is dominant to t (solid color, here black). An SsTt cat (tabby with white paws) is crossed to an SStt cat (black, with white paws). S and T are unlinked genes. What is the expected ratio of phenotypes in the next generation?
a. 1 tabby : 2 tabby with white paws :1 black
b. 3 tabby with white paws:1 black
c. 9 tabby with white paws : 3 tabby : 3 black with white paws : 1 black
d. 1 tabby with white paws : 1 tabby : 1 black with white paws : 1 black
e. 1 tabby with white paws : 1 black with white paws
d. 1 tabby with white paws : 1 tabby : 1 black with white paws : 1 black
81
New cards
In E. coli, cAMP is a signal for
a. a drop in the intracellular ATP levels
b. a drop in the extracellular lactose levels
c. a rise in the extracellular lactose levels
d. a rise in the extracellular lactose ATP levels
e. a rise in the extracellular glucose levels
a. a drop in the intracellular ATP levels
82
New cards
In general, positive regulation works
A. through an activator protein that activates transcription in the presence of a small allosteric co-activator or small molecule,
B. through an activator protein that activates transcription in the absence of a small allosteric molecule
C. through a constitutively expressed activator protein that is always active
D. A and B
E. none of the above.
D. A and B
83
New cards
In noncyclic photosynthesis the excited electrons end up...
a. back on chlorophyll
b. being used to make ATP
c. being used to reduce NADP+
d. being transported "to the other side of the membrane" to set up a proton motive force
e. transported through ATP synthase to help make ATP.
c. being used to reduce NADP+
84
New cards
In the presence of oxygen, cells oxidize glucose completely to carbon dioxide and water according to the chemical equation shown in figure 5. In the process, about 35 molecules of ATP are generated per molecule of glucose oxidized, so that some of the energy released by oxidation is recovered as usable chemical energy. The principal role of O2 in this process is to:
a. accept electrons released by glucose oxidation, forming H2O.
b. supply the oxygen for CO2 production.
c. react with glucose to cleave it into smaller fragments for further oxidation.
d. participate as a reactant in generation of ATP from ADP and Pi.
a. accept electrons released by glucose oxidation, forming H2O.
85
New cards
In the presence of oxygen, cells oxidize glucose completely to carbon dioxide and water. In the process, about 35 molecules of ATP are generated per molecule of glucose oxidized, so that some of the energy released by oxidation is recovered as usable chemical energy. Glucose is:
a. altered by a series of chemical reactions in central metabolism to become ATP.
b. broken down by a series of chemical reactions in central metabolism that lead to the production of energy.
c. oxidized by a series of chemical reactions in central metabolism, which releases energy that is then harvested by the cell
d. broken down atom by atom and incorporated into the ATP molecule, thus transferring energy from the sugar compound to ATP.
!e. A and C
c. oxidized by a series of chemical reactions in central metabolism, which releases energy that is then harvested by the cell
86
New cards
In the purine nucleotide biosynthetic pathway drawn below, the lower case letters represent enzymes required for the synthesis of GMP and AMP. The biosynthetic pathway branches at IMP. This pathway is subject to allosteric feedback regulation. If the concentration of AMP is too high, and the concentration of GMP is too low, a good way to adjust the concentration would be to have:

a. AMP acts as a negative regulator of enzyme b
b. GMP acts as a positive regulator of enzyme b
c. AMP acts as a negative regulator of enzyme e
d. GMP acts as a negative regulator of enzyme e
e. GMP acts as a negative regulator of enzyme b
c. AMP acts as a negative regulator of enzyme e
87
New cards
In the purine nucleotide biosynthetic pathway drawn in Figure 8, the numbers represent enzymes required for the synthesis of GMP and AMP. The biosynthetic pathway branches at IMP. This pathway is subject to allosteric feedback regulation. If the concentration of AMP is too high, and the concentration of GMP is too low, a good way to adjust the concentration would be to have:
a. AMP act as a negative regulator of enzyme 1
b. GMP act as a positive regulator of enzyme 2
c. AMP act as a negative regulator of enzyme 3
d. GMP act as a negative regulator of enzyme 5
e. AMP act as a negative regulator of enzyme 5
e. AMP act as a negative regulator of enzyme 5
88
New cards
In transcription of eukaryotic genes, _____ cannot bind directly to the _____. Initiation requires____.
a. RNA pol I; promoter; TFIID
b. RNA pol II; promoter; TFIID
c. RNA pol III, promoter; TFIID
d. RNA pol III; TATA box, TFIID
e. RNA pol III; TATA box, regulatory transcription factors
b. RNA pol II; promoter; TFIID
89
New cards
In what intracellular compartment is ATP synthesized via oxidative phosphorylation?
a. The nucleus
b. The cytoplasm
c. The golgi
d. The mitochondrial intermembrane space
e. The mitochondrial matrix
e. The mitochondrial matrix
90
New cards
In what intracellular compartment is ATP synthesized via oxidative phosphorylation?
a. The nucleus
b. The cytoplasm
c. The golgi
d. The mitochondrial intermembrane space
e. The mitochondrial matrix
e. The mitochondrial matrix
91
New cards
Leucine is an amino acid required for protein synthesis. How might the leucine biosynthetic operon be regulated?
a. Induced by leucine, by having leucine inhibit a repressor
b. Induced by leucine, by having leucine activate an activator
c. Repressed by leucine, by having leucine activate a repressor
d. Repressed by leucine, by having leucine inactivate an activator
e. Both c and d would work.
e. Both c and d would work
92
New cards
Look at the structure of the phospholipid in Figure 1A, hypothesize as to how multiple phospholipids stacked together may form a stable structure:
a. membrane proteins form covalent bonds with the phospholipids to hold them together.
b. Covalent bonds that stabilize the interaction of the phospholipid polar head groups with water.
c. Hydrogen bonds that stabilize the interaction of the phospholipid polar head groups with water.
d. Ionic bonds that stabilize interactions between phospholipid molecules
e.B and C only
c. Hydrogen bonds that stabilize the interaction of the phospholipid polar head groups with water.
93
New cards
Male pattern baldness is an X-linked, recessive trait. It can also be observed in women, if they are homozygous for the recessive allele. If 40% of the men in a population display "male" pattern baldness, what is the expected frequency of women with "male" pattern baldness?
a. 36%
b. 40%
c. 48%
d. 16%
e. 8%
d. 16%
94
New cards
Members of the domains archaea and bacteria
a. have nuclei
b. have chloroplasts
c. are multicellular
d. are prokaryotes
e. are eukaryotes
d. are prokaryotes
95
New cards
Men have one X chromosome, while women have two. You might think that because women have two doses of the genes on X, they'd make twice as much protein (compared with men) from these X- linked genes- but they don't. "Gene dosage" in males vs. females is balanced because:
a. Men express the same genes, but from their Y chromosome as well
b. Men double the frequency at which all their genes on X are transcribed
c. Women cut in half the frequency at which every gene on each X is transcribed
d. Women transcribe the genes on only one of the X chromosomes in any cell.
e. Women destroy the X chromosome donated by the male, immediately after fertilization.
d. Women transcribe the genes on only one of the X chromosomes in any cell.
96
New cards
Methanogenic bacteria are classified as "chemoautotrophs". They are autotrophs because they...
a. Can fix carbon from CO2
b. Can generate methane from CO2
c. Have to eat other organisms to get fixed carbon
d. Use redox reactions to make ATP
e. Recycle NADH
a. Can fix carbon from CO2
97
New cards
Methylation of C at CG sequences is often found in silenced genes. This type of methylation contributes to epigenetic gene silencing because:
a. Methyl-C is copied incorrectly by DNA polymerase
b. Methyl-C is copied incorrectly by RNA polymerase
c. Methylation patterns at CG are heritable from one cell generation to the next
d. Methylation patterns cannot be transmitted from one cell generation to the next
e. b and c
c. Methylation patterns at CG are heritable from one cell generation to the next
98
New cards
Most organisms carry a gene for "photolyase" which reverses UV-induced DNA damage. Unfortunately, we do not. We remove UV-induced DNA damage using
a. nucleotide excision repair (NER)
b. mismatch repair
c. homologous recombination
d. it is diluted during DNA replication
e. natural selection
a. nucleotide excision repair (NER)
99
New cards
Muscle cells and nerve cells in one kind of animal owe their differences in structure to...
A. having different genes.
B. having different chromosomes
C. using different genetic codes
D. expressing different genes.
E. having unique ribosomes.
D. expressing different genes.
100
New cards
NADH can be used for biosynthetic reactions, or it can be "cashed in" for ATP. NAD+ is reduced to NADH in every one of these steps except...
A. Glycolysis
B. Pyruvate oxidation
C. The citric acid cycle
D. Respiratory electron transport.
D. Respiratory electron transport.