Mic 220 - Quiz 2

DNA and RNA molecules have directionality. What does 5’ mean in DNA strands?

* An amino group attached to the '5’ carbon of the deoxyribose ring
* A hydroxyl group attached to the 5’ carbon of the deoxyribose ring
* A carboxyl group attached to the 5’ carbon of the deoxyribose ring
* A phosphate group attached to the 5’ carbon of the deoxyribose ring

D. A phosphate group attached to the 5’ carbon of the deoxyribose ring

Which of the following sequences is primarily involved in the initiation of transcription?

* Starting codon
* Promoter
* The ribosomal binding site (the Sine-Dalgarno sequence)
* *ori*

Promoter

Horizontal gene transfer (HGT) is one primary reason for increased bacterial antibiotic resistance. What are common HGT methods used by bacteria EXCEPT?

* Random mutation
* Conjugation
* Transformation
* Transduction

Random mutation

A bacterial gene is 300 bp long (ncluding the starting and stop codons). How many amino acids does the protein product encoded by this gene have?

\
* 100 (This is a wrong answer. Please don’t choose this).
* 99
* 101
* 300

99

Please use website-based *E. coli* genome databases such as EcoCyc to find the amino acid sequence for Mdh (malate dehydrogenase). Which of the following is the beginning protein sequence of 10 amino acids?

\
* MTFGVVVAVP
* MKLAVYSTKQ
* MAFGFATRSM
* MKVAVLGAAG

MKVAVLGAAG

*Clostridium tetani* DNA has 14% G (huanine). What percent of its DNA has A (adenine)?

\
* 36%
* 72%
* 28%
* 14%

36%

Protein molecules also have directionality. What does C-terminus of a protein mean?

\
* The phosphate group at the end
* The hydroxyl group at the end
* The carboxyl group at the end
* The carbohydrate at the end
* The amino group at the end

The carboxyl group at the end

Please use website-based *E. coli* genome databases such as EcoCyc to find the amino acid sequence for *mdh* gene. Which of the following sequences is the beginning 20 bp?

\
* ATGTATTATATATTGGGGCGCAA
* ATGAAACTCGCCGTTTATA
* ATGTCAAACAAACCCTTTAT
* ATGAAAGTCGCAGTCCTCGG

ATGAAAGTCGCAGTCCTCGG

Which of the following sequences is primarily involved in translation termination?

\
* Stop codon
* *dif* site
* Rho dependent sequences
* Hairpin sequences
* Ribosomal binding site (the Shine-Dalgarno sequence)

Stop codon

Which of the following sequences is a nucleotide sequence upstream to a coding sequence and is responsible for ribosome binding during the initiation of protein translation?

\
* Ribosomal binding site (the Shine-Dalgarno sequence)
* Starting codon
* *ori*
* Promoter

Ribosomal binding site (the Shine-Dalgarno sequence)