animal/plant genetics

DNA

contains thymine

RNA

contains uracil

what is DNA packed tightly around in a condensed eukaryotic chromatin

histones

DNA replication

DNA is used as a template to direct synthesis of new DNA

function of promoter elements during transcription

attract RNA polymerase to initiate expression of genes

If a bacterial strain’s DNA is 27% guanine, then the percentage adenine must be:

23%

An isolated human population is found that practices cannibalism. Individuals eat the brains of deceased, believing it passes on wisdom of the dead. These individuals typically die in their early thirties. Autopsy reveals patients have severely necrotic cerebellums. A brain extract from affected humans fed to mice causes similar symptoms in the mice. The extract was individually treated with DNAase, RNAase, protease or lipase. Both protease and lipase destroy the agent causing necrosis.

The causative agent is likely to be comprised of:

only protein and lipid

Given the chromosome with strands a AND b, which of the following is true of genes found in eukaryotic cells

a* ————————-5’

b* ————————-3’

genes can be encoded on either of the two DNA strands found in a chromosome, but any individual gene is only encoded on one strand of DNA

how many telomeres do individual eukaryotic chromosomes contain

2

in cells lacking telomerase

chromosomes will shorten with each cell division

During transcription, the promoter element must transit from a closed to an open form. This means:

The DNA of the promoter must unwind a small portion of the double helix

to admit RNA polymerase.

Given the following portion of a template strand sequence:

3’ GGATCTCAATCGA 5’

The RNA transcribed from this region will be:

5’ CCUAGAGUUAGCU 3’

Chromosomal DNA in bacteria

circular and stored in a nucleoid body

The transforming principle was demonstrated by:

Heat treating virulent Streptococcus pneumonia and using the extracted material to convert non-virulent S.pneumonia to a virulent strain.

During replication

primase must provide RNA primers on the leading and lagging strand.

What enzymatic activity destroys the transforming principle?

DNAase

The major and minor grooves of DNA

allow proteins to read the sequence of the bases

An E. coli mutant is identified that grows poorly at 32oC but normally at 37oC. RNAs synthesized at 32oC are much longer than those synthesized when the cells are grow at 37oC. The most likely gene mutated in this strain encodes:

Rho factor

The typical function of micro RNAs (miRNAs) is to

nhibit the translation of messenger RNAs

The proofreading activity of DNA polymerase

Removes incorrectly incorporated nucleotides during replication

given this segment of the human genome with the sequence:

5′ CTGAATCGGGTTGGG 3′

3′ GACTTAGCCCAACCC 5′

In order for the top strand (bold) to be replicated, which of the following items is needed?

primer with the sequence 5′ CCCAAC 3’

Which of the following components of telomerase is primarily responsible for accurate and faithful extension of the telomere ends of DNA?

RNA

which of the following proteins has, as its primary function, unwinding the double- stranded DNA at the replication fork?

helicase

The following highlighted sequence (the dots mean any nucleotide sequence of unspecified length), which is transcribed but is not present in mature mRNA, likely corresponds to:

5’ …AGGUAAGU……………………A…………UUUCCCAGG…

an intron

Replication of the region of the top DNA strand labeled “A” would entail:

Replication of the region of the top DNA strand labeled “A*” would entail:

Continuous synthesis – of the leading strand

Discontinuous synthesis – of the lagging strand

Which of the following is used as a parental template strand at some point during replication?

all of the above

When the replication fork reaches the end of the linear chromosome in eukaryotes, which newly synthesized strand is expected to NOT experience the “end-replication problem” that is overcome by telomerase function?

the leading strand

A primary function of the 3’ poly(A) “tail” put on eukaryotic transcripts is to:

increase stability of the transcript

which of the following distinguishes transcription from replication? Unlike DNA polymerase during replication:

RNA polymerase can initiate synthesis without a primer.

during protein synthesis on the ribosome, new amino acids are always

added:

o the C-terminus of the growing polypeptide chain

When the translation machinery encounters a “stop” codon:

translation is terminated by release factors (proteins) that are recruited in

response to the stop codon.

n eukaryotic cells, DNA is:

packaged into nucleosomes

during splicing

he introns are removed from the primary transcript

You discover a sequence of DNA that increases expression of a gene located 25,000 base pairs away from the sequence. The segment of DNA you identified is likely to be:

an enhancer

during the production of mature mRNAs

Splice donors pair with splice acceptors resulting in intron removal.

In Transcription, the function of promoter elements is to:

Attract RNA polymerase to initiate expression of genes.

To demonstrate the transforming principle, Frederick Griffith made use of strains of Streptococcus pneumoniae bacteria. In his experiment:

Something in the heat killed Smooth S. pneumoniae transformed the non- virulent Rough S. pneumoniae to a virulent Smooth S. pneumoniae.

During translation, the correct amino acid encoded by the mRNA is

incorporated into the growing peptide chain because

he anticodon of a correctly charged tRNA basepairs with the codon in the

mRNA.

The following mRNA is translated in a cell. Identify the encoded protein

sequence.

5’ ACAGAUGACUGCUAUCUGAAUUGUA 3’

MET-THR-ALA-ILE

Chargaff’s rules state that

all of the above

The amount of purines = amount of pyrimidines.

The amount of thymine = amount of adenine

The amount of guanine = amount of cytidine

Amount of A+T does not equal the amount of G+C