biomed final

What are all the steps to experimental design

1. Identify the experiment

2. Make a prediction

3. Design an experiment

4. Conduct the experiment

5. Analyze data

6. Communicate the findings/results

How does an independent variable differ from  a dependent variable?

1. Independent:  The variable that is being manipulated

2. Dependant:  The outcome of the experiment after variable is manipulated

3. Example:  Plant Growth vs. Fertilizer Amount

   1. Fertilizer amount is varied in 3 different pots:   Independent Variable

   2. Plant with most fertilizer grew the tallest:  Height of plant = Dependent variable.

Give 3 examples of methods to investigate crime scenes

1. Zone Method:  Divide scene into distinct zone areas (Example:  Divide a house into each respective room.

2. Spiral Method:  Start at center of crime and spiral your way outward looking for evidence (or vice versa)

3. Line Method:  Start in a long line of people, arms length apart, and everyone walks straight (used in large open areas, like a field)

What evidence can be used from a crime scene to identify suspects?

1. DNA evidence from

   1. Hair

   2. Blood

2. Fingerprints

3. Digital evidence 

   1. Cameras

   2. Cell Phones

   3. Social Media Accounts

What is PPE and why is it important in crime scene investigations?

1. Gloves:  Wear to not contaminate evidence

2. Gloves:  Wear to avoid contact with bodily fluids that can transmit disease

3. Facemask/Shields:  Keeps investigator safe, avoids evidence contamination

4. All PPE (Personal Protective Equipment) :  Shows degree of professionalism and helps keep crime scene from being contaminated

If giving a polygraph test (lie detector), what physiological signs are being monitored to check if person is “lying?”

1. Blood Pressure

2. Pulse

3. Respiration Rate

4. Skin Conductivity (sweat level increase?)

How does the fight or flight response work?

1. A stimulus surprises an individual (like a question during an interview)

2. Adrenaline is released from adrenal glands

3. Adrenaline causes an increase in:

   1. Heart rate 

   2. Breathing rate

4. These changes can be measured by a polygraph machine and interpretted

1. A bloodstain pattern can reveal what type of information?

2. Describe the structure, properties, and components of DNA.  What is the monomer of DNA?  Why is DNA considered a polymer?

1. STRUCTURE:

   1. Phosphate group

   2. Deoxyribose sugar

   3. Nitrogenous base

2. PROPERTIES

   1. Double helix structure

   2. Contains genetic information in form of genes

3. MONOMER

   1. Monomer of DNA is nucleotide

   2. DNA is considered a POLYMER because DNA is a very long chain of MONOMERS attached together in long strands

What are Chargaff’s rules of base pairing?  What type of bond is between the paired DNA bases?

1. A attaches to T in DNA base pairing

2. G attaches to C in DNA base pairing

3. Bonds between the bases are hydrogen bonds

What is a gene and what do they code for?

gene - a segment of DNA that contains instructions for building proteins; codes for a specific protein/ functioning RNA molecule

1. What are Chargaff’s rules of base pairing?  What type of bond is between the paired DNA bases?

1. A attaches to T in DNA base pairing

2. G attaches to C in DNA base pairing

3. Bonds between the bases are hydrogen bonds

1. Write the complementary DNA strand for each given strand of DNA:

   1. CGTAAGCGCTAATTA

GCATTCGCGATTAAT

1. Write the complementary DNA strand for each given strand of DNA: TCTTAAATGATCGATC

AGAATTTACTAGCTAG

What is a restriction enzyme?  Do all enzymes cut DNA in the same place?

restriction enzyme - proteins that cut DNA at specific sequences (a defense mechanism against viruses). Since each enzyme has its own unique cutting pattern, not all enzymes cut DNA in the same place

One restriction enzyme is known as HAEIII.  It cuts DNA at the following sequence:CC CC GG

GG CC

1. Use HAEIII to cut the following DNA segment

   TACCGGGAATTCATCCGGTGAATTCTAGCGTAC

   ATGGCCCTTAAGTAGGCCACTTAAGATCGCATG

How many cuts did HAEIII make?

2

How many DNA segments were produced?

3

1. Explain all the steps of protein synthesis?  Identify the 3 types of RNA.  

1. mRNA (message of order of amino acids from DNA)

2. tRNA  (brings amino acid to ribosome)

3. rRNA (ribosome)

Fill in the blanks:   All instructions for proteins, like hemoglobin, are stored in our _____, which is located in the cell’s _____.  This DNA must first be turned into ______, through a process called _______.  This process takes place in the ________.  The mRNA then takes the message to the ________, specifically to the _______.  This is where the process of ______ takes place.   A tRNA matches its ________ to a ________ on the mRNA.  The tRNA then drops off its _____  _____.  Many of these monomers make up the final _________ of hemoglobin

1. DNA

2. Nucleus

3. mRNA

4. Transcription

5. Nucleus

6. Cytoplasm

7. Ribosome

8. Translation

9. Anti-codon

10. Codon

11. Amino Acid

12. Protein

1. Write the mRNA strand for the given DNA strand.  Then use the mRNA codon wheel to determine the amino acids.

   1.  ATG TCG CTG ATA CTG

   2.  GAA GCG ATC AGT TAC

1) UAC - AGC - GAC - UAU - GAC; Tyr - Ser - Asp - Tyr - Asp 2) CUU - CGC - UAG - UCA - AUG; Leu- Arg - Stop

1. What is an autopsy, who performs it, and when is when required?

1. Performed by pathologist / forensic pathologist

2. Autopsy is medical exam of person’s body after they have died

1. What is the difference between cause of death and manner of death?   What is the difference between cause of death and mechanism of death?

1. Cause of death:  The actual disease, injury or condition that started the process that led to the death (gunshot, car accident, overdose, cancer)

2. Mechanism of death:  Specific body failure.  Describes how the body stopped working (Respiratory failure, heart attack, blood loss)

3. Manner of death:  Legal classification that explains how the death happened (accidental, natural, homicide)

What is the difference between a coroner and medical examiner?

1. Coroner:  Someone who investigates and investigates cause and manner of death.  They are not necessarily doctors.  They do not perform autopsy

2. Medical Examiner:  Always a doctor.  Performs autopsy.  Determines cause of death.

What are the four (4) parts of blood?  Describe each parts function.

Plasma - carries cells and nutrients, RBC - transports oxygen using hemoglobin, WBC - body’s defenders; Platelets - form clots to help repair vessels

1. Use a picture to demonstrate the relationship between DNA, chromosomes, and genes.

1. DNA is the molecular blueprint that carries genetic information.

2. Chromosomes are structures made of DNA that organize and package genetic material.

3. Genes are segments of DNA that code for specific traits or functions.

What is a karyotype?  What type of genetic disorder can be diagnosed using a karyotype?  Provide an example.

A visual representation of an individual’s chromosomes, organized by size and shape, is used to help identify chromosomal abnormalities that can lead to genetic disorders

Make a chart to compare mitosis and meiosis.

mitosis is a process that occurs in non sex cells (2x) while meiosis occurs in sex cells (4x)

What does HIPAA stand for?   What is its purpose? 

• HIPAA stands for the Health Insurance Portability and Accountability Act.

• It was enacted in 1996 to protect patient health information.

1. What is a Punnett square?  What medical profession would use a Punnett square in their daily routine?

• A Punnett square is a diagram used to predict the genetic makeup of offspring. Genetic counselors frequently use Punnett squares in their practice to assess inheritance patterns.

What are sickled red blood cells?  What causes red blood cells to become sickled?

Sickled red blood cells are red blood cells that have an abnormal crescent or "sickle" shape instead of the normal round, flexible disc shape, caused by a genetic disorder called Sickle Cell Disease

How is anemia diagnosed?  What are the results for a healthy patient vs. an anemic patient?

with a complete blood count (measures hemoglobin levels, red blood cell count, and hematocrit

What health complications are caused by sickled red blood cells?  Identify which body system the sickled red blood cells are affecting.

anemia (shortage of red blood cells), stroke (blocked blood flow to the brain), organ damage (reduced oxygen flow → kidney, liver, spleen)

What is the difference between experimental probability of inheritance and theoretical probability of inheritance?

experimental probability - based on actual experiments; theoretical probability 0 expected outcomes calculated mathematically

A father is Ss for sickle cell anemia and mother is also Ss. Use a Punnett square to calculate the probability of having a child with sickle cell. S (normal) s (sickle cell allelle)

SS - 25%, Ss - 50% (carrier), ss - 25 (sickle cell disease)

Compare and contrast sickle cell disease and Best disease.  What do you know about the inheritance of each disease?

in order to contract sickle cell disease you need two of the recessive (bad) traits to contract sickle cell disease vs with best disease you need only one of the recessive traits to contract best disease

Why is glucose important for our cells?

Main source of energy; lets cells makes ATP which gives organs the fuel to function

What is the difference between hyperglycemia and hypoglycemia.

Hyperglycemia - blood potassium is too high; hypoglycemia - blood potassium is too low

Describe two (2) complications in the human body system caused by Type 1 and Type 2 diabetes.

cardiovascular system and nervous system complications (both type 1 and 2)

What is heart rate?  What is normal heart rate in healthy adults?

heart rate - number of times your heart beats per minute; 60-100 bpm

What is blood pressure?  What is normal blood pressure in a healthy adult?  How is blood pressure measured?   What is the difference between systolic and diastolic?  What units are used in blood pressure measurement?

Blood pressure is the force of blood pushing against the walls of the arteries as the heart pumps blood throughout the body; 120/80; bp cuff + stethoscope; systolic is the pressure in arteries when the heart contracts and pumps blood (top number) while diastolic is the the pressure in the arteries when the heart relaxes between beats (bottom number); mmHg (millimeters of mercury)

What is the connection between polymerase chain reaction (PCR), restriction enzymes, and gel electrophoresis?  What can these processes be used to analyze?

often used together in DNA analysis. (PCR copies the DNA, restriction enzymes cut the amplified DNA into fragments, Gel electrophoresis separates the fragments so they can be visualized and compared

What causes DNA to run across/down a gel electrophoresis?  (Charge of molecule vs. machine)

because of the interaction between the charge of the DNA molecules and the electric field produced by the machine.

Explain the difference between a gram negative and gram positive bacteria.  How is each stained?

Gram-positive bacteria’s thick layer can trap the crystal violet stain, while the thin layer cannot retain it after decolorization

Explain a positive feedback loop?   Compare to a negative feedback loop?

A change in the body causes responses that increase or amplify that change (positive), a mechanism in which a change in the body triggers responses that reverse or counteract that change, helping maintain a stable internal environment (homeostasis).

How are infectious agents contracted (Mode of Transmission

shaking hands, direct contact with an infected person/surface

What is empathy?   How is empathy different from demeanor?  How does demeanor differ from tact?

empathy - the ability to understand and share another person's feelings, perspectives, or experiences (“How does this person feel?”) demeanor - the external way a person appears or behaves. tact - the ability to communicate or act in a way that avoids upsetting others (“How can I say this appropriately?”). Demeanor is just appearance, but tact is how you deliver it. A person could have a warm and friendly demeanor, but could be blunt and have poor tact

What are the four (4) main parts of a medical interview?

Medical History, Chief complaint, Physical signs, Symptoms

What are the normal ranges for the following vital signs:

Blood Pressure

120/80 is top range of normal.  Can be slightly lower for systolic and diastolic and be healthy

Pulse

60-100 beats per minute

Respiration Rate

12-20 breaths per minute

Temperature

98.6 is considered normal  (100.4 or above is fever); normal range is 97.9-99.1

Oxygen saturation

95-100%

What is hypertension?

 High blood pressure  >120 systolic and/or >80 diastolic

What is hypotension?

 Low blood pressure

What is hypothermia? At what temperature does a person clinically have a fever?

Low temperature, 100.4

How does bradycardia differ from tachycardia?

Bradycardia = low heart rate   Tachycardia = high heart rate

Why is it important to take a patient's vital signs at every clincial visit?

it can reveal early signs of illness/change in condition

Where are three areas to take an accurate pulse?

radial (wrist), carotid (neck), and brachial (inner elbow)

When looking at a patient’s eyes, what symptoms might indicate an issue? 

Redness, swelling, pus/discharge, corneal abrasions, changes in color or appearance of the retina

When looking at a patient’s ears, what symptoms might indicate an issue?

(redness or bulging of the eardrum might indicate fluid or swelling)

When looking into a patient’s mouth and throat, what symptoms might indicate an issue?

(red, inflamed tonsils, white patches of infected tissue on tonsils, swollen lymph nodes)

What is the ideal location to take the body temperature of a corpse/victim?

Rectal temperature

What is rigor mortis?  How does rigor mortis differ from livor mortis?

Rigor mortis = stiffening of muscles in extremities

Livor mortis = pooling of blood after death in area closest to ground

  L.M = if body face down, blood will pool in chest/abdomen

    L.M = if body standing, blood will pool in feet and lower legs

If the body temperature of a victim is measured to be 90.3 degrees, using the Glaiser formula, determine the approximate time of death.

(98.4 - 90.3)  /  1.5 = 5 hours 24 minutes

What is algor mortis?

Change in the corpse’s body temperature after death

What does the presence of insects on a corpse indicate?

Corpse has been there for more than a few hours

What causes rigor mortis to end?

Decomposition of the body

What does low white blood cell count indicate?   High white blood cell count?

1) anemia, malnutrition, kidney issues; 2) dehydration, heart/lung disease, polycythemia

What does low red blood cell count indicate?   High red blood cell count?

1) anemia → iron deficiency, poor nutrition, chronic diseases, bone marrow disorders; 2) dehydration, polycythemia, low oxygen levels

What does low platelet count indicate?   High platelet count?

1) bone marrow affecting production, autoimmune diseases (lupus) → increased bleeding/bruising due to insufficient clotting 2) a response to inflammation/infection in the body, bone marrow disorders, iron deficiency → blood clots

What is hemoglobin?

the protein in blood that oxygen attaches to within the blood cell

What does low hemoglobin indicate? High hemoglobin count?

1) blood loss, low iron; 2) bone marrow overproduction, heart/lung condition, dehydration

What is a hematocrit?

proportion of red blood cells in the blood

What does a low hematocrit indicate? High hematocrit?

not enough RBC in blood, producing too many RBC, can be caused by dehydration