Genetics Unit 3

If you are trying to isolate enhancers of genes expressed in the brain, what library would be best to use?

a genomic library made from mouse cells

In a Sanger Sequencing reaction, for what two reasons are the dideoxynucleotides (ddNTPs) important for the process?

ddNTPs are tagged with a unique fluorescent molecule AND they are missing a 3' -OH which stops the replication reaction.

The ApaI restriction endonuclease has the recognition sequence 5' GGGCC^C 3' where the ^ indicates the place that Apa will cut the DNA. Remember that restriction enzyme sequences are palindromic. Assuming random nucleotide sequence, what is the average size of fragments that will be produced when DNA is cut with ApaI?

4,096 bp

The ApaI restriction endonuclease has the recognition sequence 5' GGGCC^C 3' where the ^ indicates the place that Apa will cut the DNA. Remember that restriction enzyme sequences are palindromic. Will the ApaI enzyme produce sticky ends or blunt ends in the DNA?

sticky ends with 3' overhang

If you are trying to isolate all genes expressed in the brain of adult mice, what library would be best to use?

a cDNA library made from adult mouse brain tissue

Design a PCR primer that will bind to the bolded region of DNA and initiate DNA synthesis moving from left to right: 3' ATCGTAATAAACGTATCCGGAGTACAG 5’

5' ATTTGCATAGG 3'

In a Arabidopsis genome, the genes CUL-1 and CUL-2 have similar but not identical functions. A DNA sequence comparison of CUL-1 and CUL-2 show several large regions of identical DNA sequence, but also regions where the sequence differs between the two genes. Given this information, you can surmise that CUL-1 and CUL-2 are:

paralogs

Fragile X syndrome is caused by expansion of a trinucleotide repeat in the 5′ UTR of the FMR-1 gene. What is the simplest way to detect this expansion?

PCR using two primers that are complementary to unique sequences on either side of the repeat region, followed by electrophoresis.

What technique can help identify a disease gene quickly by narrowing the focus?

Compare the genome sequences of different species to identify amino acids that are conserved in various encoded proteins.

The disease cystic fibrosis is caused by a mutation in the gene encoding the CFTR protein, which is an ion channel protein. A cystic fibrosis patient's DNA is sequenced at the CTFR gene locus, and the data show the patient has two mutated copies of the CFTR gene. However, the patient has two different mutated alleles. (The alleles are not identical, in other words.)
Which of the following phenomena is illustrated by the patient's DNA in this example?

Compound heterozygosity

Identifying candidates for a disease gene by positional cloning depends on distinguishing DNA markers that are close to the disease gene from markers that are far away. When the disease gene is close to a marker, there will be

a low rate of recombination between the disease gene and the marker.

What are restriction enzymes?

Enzymes that cut DNA at specific recognition sequences

Where do restriction enzymes come from?

Bacterial defense against viral DNA

Sticky ends vs blunt ends?

Sticky: overhangs (5’ or 3’); Blunt: no overhangs

What is recombinant DNA?

DNA formed by combining DNA from different sources

What enzyme joins DNA fragments?

DNA ligase

What is a plasmid?

Circular DNA used as a cloning vector

Key features of plasmids?

Origin of replication, antibiotic resistance gene, MCS (polylinker)

Why clone genes?

Study genes, produce proteins, transfer genes

Step 1 of cloning

Cut vector and insert with restriction enzyme

Step 2 of cloning

Ligate DNA fragments

Step 3 of cloning

Transform bacteria

Step 4 of cloning

Select with antibiotic

Step 5 of cloning

Screen for recombinant clones

Transformants vs non-transformants

Transformants have plasmid; non-transformants do not

Purpose of gel electrophoresis

Separate DNA by size

Direction DNA moves in gel

Toward positive (red) electrode

What determines DNA migration?

Size (smaller moves faster)

How is DNA visualized?

Fluorescent dye (e.g., ethidium bromide)

What enzyme is used in Sanger sequencing?

DNA polymerase

What is required for Sanger sequencing?

Template, primer, dNTPs, ddNTPs

What do ddNTPs do?

Terminate DNA synthesis

Why do ddNTPs stop synthesis?

Lack 3’-OH group

How is sequence read?

From fluorescent peaks (5’ → 3’)

Why are overlapping sequences needed?

To reconstruct full genome

What is a genomic library?

Collection of all DNA fragments of genome

What is a cDNA library?

DNA made from mRNA (expressed genes only)

Key enzyme for cDNA

Reverse transcriptase

Genomic vs cDNA library

Genomic: all DNA; cDNA: expressed genes only

What is an ORF?

Open reading frame (no stop codons)

What is genome annotation?

Identifying genes and functional regions

What complicates genome annotation?

Repetitive DNA, alternative splicing, gene families

What are pseudogenes?

Nonfunctional gene-like sequences

Gene families arise from

Duplication and divergence

What is BLAST?

Tool to compare sequence similarity

What is an E-value?

Probability match occurred by chance

What is RefSeq?

Reference genome for a species

What is GenBank?

Database of DNA sequences

Structure of hemoglobin

2 alpha + 2 beta chains

Why different hemoglobins during development?

Optimize oxygen binding

What controls globin expression?

Locus Control Region (LCR)

Cause of sickle cell anemia

Missense mutation in beta-globin gene

Cause of thalassemia

Reduced globin production

What is a SNP?

Single base change

What is an InDel?

Insertion or deletion of bases

What is an SSR?

Short tandem repeat

What is a CNV?

Large repeated DNA segments

Why are polymorphisms useful?

DNA markers for tracking traits/disease

What is PCR?

Technique to amplify DNA

Key components of PCR

Template, primers, Taq polymerase, dNTPs

PCR steps

Denature (~95°C), Anneal (~55°C), Extend (~72°C)

What happens each PCR cycle?

DNA doubles

How detect SNP genotype?

Sequencing

How detect SSR genotype?

PCR + gel electrophoresis

Why are SSRs useful?

Variable repeat number

What is DNA fingerprinting?

Using SSRs to identify individuals

Why are SSRs ideal?

Highly variable and unlinked

What system is used in the US?

CODIS

What are continuous traits?

Traits with a range of values

What controls continuous traits?

Multiple genes (polygenic)

What influences them?

Genes and environment

Goal of positional cloning

Identify disease genes using markers

What is a LOD score?

Measure of likelihood of linkage

Significant LOD score

≥ 3

Steps of positional cloning

Map → sequence → identify candidate gene

Allelic heterogeneity

Different mutations in the same gene

Compound heterozygosity

Two different mutant alleles

Locus heterogeneity

Different genes cause same disease

What is CRISPR?

Genome editing system from bacteria

Role of Cas9

Cuts DNA

Role of guide RNA

Targets DNA sequence

What can CRISPR do?

Knockout or knockin genes

What is gene therapy?

Using DNA to treat disease

In vivo vs ex vivo

In vivo: inside body; Ex vivo: outside body

CRISPR advantage

Precise editing and efficient repair

What is a knockout mouse?

Gene is inactivated

What is a knockin mouse?

Specific mutation inserted

What are ES cells?

Stem cells used for genetic modification

What is a conditional knockout?

Gene turned off in specific tissue or time

What determines whether a restriction enzyme creates sticky or blunt ends?

The position of the cut within the recognition sequence

What are sticky ends?

DNA ends with single-stranded overhangs that can base-pair

Difference between 5′ and 3′ overhangs?

5′ overhang extends at 5′ end; 3′ overhang extends at 3′ end

What are blunt ends?

DNA fragments with no overhangs

Why are palindromic sequences important?

Restriction enzymes recognize palindromic DNA sequences

Difference between complete and partial digestion?

Complete cuts all sites; partial cuts some sites producing longer fragments

Linear vs circular DNA digestion fragments?

Linear: cuts + 1 fragments; Circular: cuts = fragments

What do ddNTPs do?

Terminate DNA synthesis and are fluorescently labeled

Why do ddNTPs stop replication?

They lack a 3′-OH so DNA polymerase cannot add nucleotides

What strand is read in sequencing output?

Newly synthesized strand (5′ → 3′)

How do you read a sequencing chromatogram?

Read colored peaks left to right